Información

¿Cómo puedo obtener la región codificante de las secuencias de genes?

¿Cómo puedo obtener la región codificante de las secuencias de genes?


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Entonces, tengo un archivo con más de 600 secuencias de un gen, cada una de una población diferente. Este archivo se obtuvo tras bombardear las secuencias de cromosomas contra la secuencia del gen. Sin embargo, también necesito las regiones de codificación. ¿Debería hacer lo mismo y bombardear los cromosomas contra los exones, o debería bombardear las secuencias de genes contra los exones?


No toda la secuencia exónica es codificante. Los extremos tienen UTR de 3 'y 5'.

¿Puedes encontrar gtfs para tu organismo? Sería más fácil trabajar con ellos.

O haría blastx contra la proteína, que debería extraer solo la secuencia que codifica la proteína.


Recursos bioinformáticos del NCBI: Introducción: Buscar secuencias

Objeto: Comenzando con un organismo y una proteína, encuentre una secuencia de proteínas y una región codificadora de genes.

Ejemplo: Encuentre la secuencia de proteínas y la región de codificación del gen para el factor de patogenicidad listeriolisina O de la bacteria Listeria monocytogenes.

Búsqueda de información genética y proteica

Comience la búsqueda en Gene, porque tiene menos redundancia que Protein (esta misma búsqueda en Protein recupera más de 700 registros).

Buscar: Listeria monocytogenes [organismo] Y listeriolisina O [nombre de la proteína]

Un registro, por símbolo genético hly, se recupera. Está asociado con un número de acceso NC_ (para especificar una molécula genómica completa que suele ser un conjunto de referencia, consulte los números de acceso y tipos de moléculas de RefSeq).

Para encontrar el secuencia de codificación de genes, mira el Regiones, transcripciones y productos genómicos sección o la Secuencias de referencia NCBI (RefSeq) sección del registro genético:

Al hacer clic en el GenBank enlace muestra el registro de GenBank en el Nucleótido base de datos. los secuencia de codificación porque el gen hly se puede encontrar bajo CDS en el Características sección del registro (delineada en rojo):

El registro de GenBank para este gen también muestra su ubicación en el cromosoma y la traducción secuencia de proteínas (delineado en azul). La secuencia de la proteína también se puede encontrar haciendo clic en el número de acceso a la proteína en el registro de nucleótidos o en el RefSeq sección del registro de genes.


Conjuntos de genes de referencia humanos

Desde la publicación del borrador de la secuencia del genoma humano en 2001 [6, 7], se han creado varios conjuntos de referencias de genes humanos utilizando predicción computacional o anotación manual o una combinación de los dos métodos. El proyecto Ensembl se estableció inicialmente para almacenar y anotar la gran cantidad de datos genómicos inacabados que se están produciendo como parte del proyecto público del genoma humano, así como para proporcionar capacidad de navegador tanto para secuencias como para anotaciones (Figura 2). Ensembl se ha expandido y ahora genera predicciones automáticas para más de 35 especies. El proceso de construcción de genes Ensembl se basa en alineaciones de secuencias de proteínas y ADNc para producir un conjunto de genes de alta precisión con una baja tasa de falsos positivos [19].

Navegador ENSEMBL. La página ContigView del navegador Ensembl que representa el SPAG4 locus del gen en el cromosoma 20 dentro de la región Encode ENr333. (a) La transcripción verde representa la región de codificación CCDS acordada por el consorcio CCDS. (B) Las transcripciones azules son las transcripciones Vega, que son anotadas manualmente por el grupo HAVANA y son una mezcla de transcripciones codificadas (azules sólidos) y no codificantes (contorno azul). (C) Finalmente, la transcripción dorada representa la transcripción de codificación en la que coinciden las anotaciones HAVANA y Ensembl.

Otro buscador del genoma que proporciona datos de secuencia y anotación para un gran número de genomas es la base de datos del buscador del genoma de la Universidad de California, Santa Cruz (UCSC) [20]. En abril de 2007, UCSC lanzó una versión mejorada de su 'Conjunto de genes conocidos' para el genoma humano e incluyó ARN no codificantes putativos, así como genes codificantes de proteínas. Cada entrada de este conjunto requiere el respaldo de una entrada de GenBank y al menos otra línea de evidencia, excepto los ADNc curados, que no requieren otra evidencia.

La anotación manual todavía juega un papel importante en la anotación de genomas terminados de alta calidad. Actualmente, la colección de secuencias de referencia (RefSeq) del Centro Nacional de Información Biotecnológica (NCBI) proporciona un recurso altamente curado (manualmente) de transcripciones de múltiples especies, incluidas secuencias de plantas, virales, vertebrados e invertebrados [21, 22]. Estos, como su nombre lo indica, están orientados a la transcripción y generalmente se basan en ADNc de longitud completa para una curación confiable, aunque el conjunto de datos también contiene predicciones usando etiquetas de secuencia expresada (EST) y ADNc parciales alineados contra la secuencia genómica usando el programa de predicción Gnomon [23 ]. Las secuencias de nucleótidos de RefSeq revisadas manualmente comienzan con el identificador NM de referencia, mientras que las predicciones no revisadas tienen el identificador XM. Cuando se secuencia inicialmente un nuevo genoma, los investigadores suelen utilizar el conjunto de datos RefSeq para identificar genes que faltan o identificar reordenamientos genómicos dentro de los genes, ya que RefSeq se utiliza internacionalmente como estándar para la anotación del genoma [21]. RefSeq es un conjunto de referencia de genes muy confiable, pero también conservador. Otros conjuntos de referencia suelen incluir RefSeq, pero lo amplían sustancialmente. Por ejemplo, UCSC 'Known Genes' tiene un 10% más de genes codificadores de proteínas, aproximadamente cinco veces más genes codificadores putativos y el doble de variantes de corte y empalme que RefSeq.

Un enfoque diferente para la anotación manual de genes es anotar transcripciones alineadas con el genoma y tomar las secuencias genómicas como referencia en lugar de los ADNc. Así es como el grupo HAVANA del Wellcome Trust Sanger Institute produce su anotación sobre la secuencia de vertebrados. Actualmente, sólo tres genomas de vertebrados - humano, ratón y pez cebra - están siendo completamente terminados y secuenciados a una calidad que amerita una anotación manual [24]. La secuencia genómica terminada se analiza utilizando una tubería de Ensembl modificada [25], y BLAST resultados de ADNc / tecnologías ecológicamente racionales y proteínas, junto con varios ab initio predicciones, se pueden analizar manualmente en la herramienta de navegación de anotaciones Otterlace. La ventaja de la anotación genómica en comparación con la anotación de ADNc es que se pueden predecir más variantes de corte y empalme alternativas, ya que se pueden utilizar pruebas de EST parcial y pruebas de proteínas, mientras que la anotación de ADNc se limita a la disponibilidad de transcripciones de longitud completa. Además, la anotación genómica produce un análisis más completo de pseudogenes. Sin embargo, una desventaja es que si se produce un polimorfismo en la secuencia de referencia, no se puede anotar una transcripción codificante, mientras que la anotación de ADNc puede seleccionar la forma haplotípica principal y, por lo tanto, no está limitada por una secuencia de referencia.

En 2006, los grupos mencionados anteriormente (NCBI (RefSeq), UCSC, Wellcome Trust Sanger Institute (HAVANA) y Ensembl) identificaron la necesidad de colaborar y producir un conjunto de genes de consenso para el genoma de referencia humano ya que todavía no había un acuerdo oficial entre las diferentes bases de datos sobre los genes codificadores de proteínas humanas. Conocido como Consensus Coding Sequence Set (CCDS) [26], actualmente contiene solo aquellas transcripciones de codificación que son equivalentes en la construcción de genes de cada base de datos desde el codón de inicio hasta el codón de parada. El último lanzamiento de CCDS humano (mayo de 2008) contiene 20,151 secuencias codificantes de consenso que representan 17,052 genes. Por primera vez, esto proporciona a los investigadores un conjunto de genes confiable y consistente que se ha derivado de forma independiente a partir de una combinación de anotación manual y automatizada por tres grupos (Ensembl, NCBI y HAVANA) y se verificó la calidad en la UCSC. Los genes que codifican proteínas que difieren entre los conjuntos de genes de los diferentes grupos y que no pueden fusionarse automáticamente se volverán a examinar manualmente y se rechazarán o agregarán al conjunto de consenso si obtienen un voto unánime de los grupos de NCBI, UCSC y HAVANA. .

Complementario al proyecto CCDS es el proyecto GENCODE [27]. El consorcio GENCODE [28] se formó inicialmente para identificar y mapear todos los genes que codifican proteínas dentro de las regiones seleccionadas en el marco del proyecto ENCODE [29, 30], lo que representa el 1% de la secuencia del genoma humano. Esto se logró mediante una combinación de anotación manual inicial de HAVANA, predicciones computacionales y validación experimental, y el consiguiente refinamiento de la anotación sobre la base de estos resultados experimentales. El proyecto ha sido financiado en 2008 para anotar toda la secuencia del genoma humano de referencia y verificar experimentalmente varios loci putativos. La anotación ampliada incluye la identificación de pseudogenes y loci no codificantes respaldada por pruebas de transcripción. La anotación manual inicial se compara con predicciones automatizadas para resaltar inconsistencias basadas en análisis comparativos o nuevos datos de transcripciones. Se espera que, una vez finalizado en 2011, este conjunto de genes se convierta en el conjunto de referencia de genes humanos estándar.


Pregunta: PCR a continuación, puede ver: Figura A: Secuencia de ADN (800 Nt desde el primer ATG hasta el último TAA) con posiciones de los sitios de las enzimas de restricción Figura B: Los sitios de clonación múltiple (MCS) del ADN plasmídico, y Figura C: El Actividades de las enzimas de restricción enumeradas en tres tampones comunes. Tarea: Necesitará encontrar una estrategia para introducir la región de codificación.

Figura C: las actividades de las enzimas de restricción enumeradas en tres tampones comunes.

Tarea: Deberá encontrar una estrategia para introducir la región codificante del gen (desde el primer ATG hasta el último TAA) en los sitios de clonación múltiple (MCS) del vector mediante PCR y técnicas de clonación molecular.

Para esta tarea necesitará:

(Tarea 1) para seleccionar dos enzimas de restricción en MCS para introducir su ADN (5 puntos)

(Tarea 2) para diseñar cebadores de PCR directos e inversos, que contienen las secuencias de los sitios de restricción seleccionados (10 marcas por cada cebador = 20 marcas en total)

(Tarea 3) Calcule la Tm de ambos cebadores (5 puntos para cada uno, 10 puntos en total).


Pregunta: Considere la siguiente secuencia de ADN en una región de codificación de un gen: 5 ’- A T G A A G A G G A G T C C - 3’ 3 ’- T A C T T T C T C C T C A G G - 5 1) Usando la hebra superior como hebra de codificación, ¿cuál sería la secuencia del ARNm transcrito? 2) Usando el código genético, ¿cuál es la secuencia de aminoácidos de este polipéptido? 3) Una mutación puntual.

Considere la siguiente secuencia de ADN en una región codificante de un gen:

5 '- A T G A A A G A G G A G T C C - 3 '

3 ’- T A C T T T C T C C T C A G G - 5

1) Utilizando la hebra superior como hebra codificante, ¿cuál sería la secuencia de la

2) Usando el código genético, ¿cuál es la secuencia de aminoácidos de este polipéptido?

3) Se produce una mutación puntual en la posición subrayada. La secuencia de ADN es

5 '- A T G A A A G C G G A G T C C - 3 '

3 ’- T A C T T T C G C C T C A G G - 5’

¿Cómo afecta esta mutación a la secuencia de aminoácidos de la proteína? (escribe la nueva secuencia de aminoácidos)

4) La inserción de una base provoca una mutación ___________________________


Codificación, análisis de secuencias de codificación y predicción de genes

Busque en este recurso completo de BAC para encontrar el mapeo, la secuencia, la anotación y los datos funcionales disponibles para cada BAC para diferentes especies.

Buscar y clasificar elementos genéticos móviles procariotas (MGE).

Predecir genes comparando secuencias genómicas de organismos relacionados con la evolución entre sí.

Encuentre información sobre elementos ricos en Au en las regiones 3 'no traducidas (UTR) de ARNm de vertebrados.

Predecir genes en secuencias genómicas eucariotas basándose en un modelo de Markov oculto generalizado.

Una base de datos de búsqueda de ORF alternativos para más de 600 genomas microbianos completamente secuenciados.

Predecir marcos de lectura abiertos (ORF) de bacteriocina putativos en una secuencia de ADN.

Detecta y muestra un sesgo de secuencia específico de posición estadísticamente significativo con ruido de fondo reducido.

Encuentre la contaminación del vector en una secuencia de nucleótidos.

Encuentre regiones sospechosas de contener secuencias codificantes y visualice la diversidad de nucleótidos entre dos secuencias genómicas o genómicas.

Identificar etiquetas de secuencias conservadas codificantes y no codificantes mediante la comparación del genoma entre especies.

Encuentre la suma del uso de codones de un organismo de una lista de 23093 organismos (2004).

Busque secuencias de fusión en genomas humanos, de ratón y de rata.

Mida el sesgo de uso de codones sinónimos dentro y entre genomas.

Busque regiones de baja complejidad en secuencias largas y estime la complejidad de grupos de secuencias alineadas.

Encuentra la isla CpG en una secuencia de nucleótidos.

Encuentre información sobre las propiedades moleculares de los dinucleótidos.

Predecir genes eucariotas basándose en el análisis comparativo de secuencias homólogas.

Predecir y evaluar estadísticamente los marcos de lectura abiertos (ORF) procariotas predichos.

Busque información específica de genes en la base de datos NCBI.

Extraiga la secuencia y la anotación de características, como la estructura de intrón / exón, de las entradas de GenBank y otros archivos de formato de GenBank.

Predecir regiones codificantes en secuencias procariotas y eucariotas maduras.

Un algoritmo desarrollado para la selección óptima de codones utilizando algoritmos genéticos.

Caracterizar y clasificar secuencias de nucleótidos según el paradigma de firma genómica.

Predecir las ubicaciones y estructuras exón-intrón de genes en secuencias genómicas de vertebrados, invertebrados y plantas.

Compare entre segmentaciones genéticas (codificantes / no codificantes) y físicas (hélice / espiral) de las secuencias de ADN.

Predecir genes en secuencias genómicas procariotas, eucariotas y virales.

Predecir genes en secuencias de ADN con diferentes herramientas de software.

Examinar el genoma humano en busca de retrovirus endógenos humanos (HERV).

Búsqueda de información sobre pseudogenes procesados ​​con anotaciones en genomas completos.

Busque puntos de recombinación meiótica en el genoma humano.

Visualice secuencias de inserción en genomas procarióticos de ISfinder.

Busque secuencias de inserción bacteriana (IS).

Acceso a bancos de datos de secuencias y a muchas herramientas de análisis de secuencias de proteínas y ácidos nucleicos.

Buscar islas en secuencias de ADN genómico procaritoico y analizar la filogenia de las integrasas asociadas.

Adapte el uso del codón del gen diana a los huéspedes de expresión para mejorar la síntesis de proteínas heterólogas.

Encuentre retrotransposones LTR de longitud completa en secuencias del genoma.

Predecir características en secuencias biológicas.

Busque microsatélites no redundantes extraídos de genomas procarióticos completamente secuenciados.

Detecta la firma de la selección natural a nivel molecular.

Encuentre predicciones de microARN diana y perfiles de expresión en este recurso integral.

Encuentre marcos de lectura abiertos (ORF) presentes en una secuencia de nucleótidos.

Encuentre información sobre datos de metilación a partir de datos de secuenciación de próxima generación.

Busque datos experimentales sobre ubicaciones y características de los sitios de formación de nucleosomas.

Una aplicación PHP en línea que optimiza el uso de codones de una secuencia de ADN para aumentar su nivel de expresión.

Analice grandes cantidades de tecnologías ecológicamente racionales o ADNc de mamíferos y hongos.

Busque una colección en evolución de clones de Open Reading Frame (ORF) humanos y de ratón (UltimateTM ORF Clones).

Plataforma web para el análisis de agrupaciones y especies cruzadas de datos de microarrays.

Identificar regiones codificantes de proteínas en secuencias derivadas de etiquetas de secuencia expresada (EST).

Predecir genes que codifican proteínas en secuencias de ADN ambientales breves.

Busque el grupo de ortólogos pronosticado de 55 especies.

Enmascare las tecnologías ecológicamente racionales para las repeticiones, sin utilizar una biblioteca.

Rastrea secuencias de origen retrotranspuesto puntuando los resultados de la firma de una inserción mediada por L1 dentro de un genoma.

Encuentre secuencias que representen genomas, transcripciones y proteínas.

Busque secuencias e información experimental asociada sobre genes sintéticos (diseñados artificialmente) de todos los estudios revisados ​​por pares.

Busque ADN repetido en tándem corto en el genoma humano.

Realice análisis de datos de secuencia de venta de alto rendimiento.

Detecta, analiza y visualiza transcripciones alternativas.

Utilice una colección de herramientas bioinformáticas en este sitio del portal.

Realizar anotaciones funcionales de transcripciones de ARNm.

Identifique los ADNc de EST de longitud completa y anote funcionalmente los ADNc de EST.

Busque información completa sobre códigos genéticos.

Una base de datos en progreso dedicada al análisis no redundante y la clasificación basada en la evolución de elementos genéticos móviles.

Búsqueda de información genética anotada de etiquetas de secuencia expresada (EST) en diferentes organismos eucariotas.

Busque información sobre genes y fenotipos animales para los que se hayan informado efectos sobre los padres de origen.

Busque genes de tRNA y snoRNA en secuencias genómicas.

Contiene información sobre el tipo y la familia específicos de los TE, la ubicación genómica y del ARNm, la secuencia, la adhesión del transcrito de apoyo y la alineación con la secuencia de consenso del TE.

Busque la presencia de elementos UTR en una secuencia de nucleótidos.

Busque elementos funcionales de UTR en secuencias de consulta.

Encuentre 3'UTR y sus elementos funcionales en C. elegans, incluidas las secuencias 3'UTR, visualizaciones gráficas, elementos funcionales predichos y validados, predicciones de estructura secundaria y otros datos detallados.

Una base de datos relacional basada en la web de microsatélites presentes en secuencias unigenas que cubren 80 genomas.

Encuentre información de mapeo y expresión para un grupo unigénico (tecnologías ecológicamente racionales y secuencias de ARNm de longitud completa organizadas en grupos que representan cada uno un gen único conocido o putativo)

Identificar la contaminación del vector en las secuencias de ácidos nucleicos.

Un recurso público en línea para identificar o diseñar sondas de sobrehibridación "universales" a partir de secuencias conservadas que se pueden usar para seleccionar de manera eficiente una o más bibliotecas genómicas de un grupo designado de especies.

Encontrar contaminación de secuencia de vector en una secuencia de nucleótidos

Busque anotaciones e información de secuencia para muchos vectores de uso común en biología molecular.

Un servicio público de procesamiento de secuencias para trazas EST sin procesar.

Busque todas las secuencias de ADN que codifican proteínas eucariotas contenidas en GenBank y encuentre anotaciones en los sitios de empalme y las fases intrónicas.

Busque datos completos de secuencias de microARN, anotaciones y objetivos genéticos predichos.

Localice microARN derivados de TE.

Calculadora de puntuación de posicionamiento de nucleosomas y energía de deformación.

Proporciona información sobre piRNA en humanos, ratones, ratas y Drosophila.

Utilice máquinas de vectores de soporte para la clasificación del origen de las etiquetas de secuencia expresadas que provienen de bibliotecas de ADNc de huéspedes mixtos.

El Sistema de Bibliotecas de Ciencias de la Salud apoya a las Ciencias de la Salud en la Universidad de Pittsburgh.

& copy 1996 - 2014 Health Sciences Library System, Universidad de Pittsburgh. Reservados todos los derechos.
Póngase en contacto con el webmaster


Biología 171

Al final de esta sección, podrá hacer lo siguiente:

  • Discutir el papel de los factores de transcripción en la regulación genética.
  • Explicar cómo los potenciadores y represores regulan la expresión génica.

Al igual que las células procariotas, la transcripción de genes en eucariotas requiere la acción de una ARN polimerasa para unirse a una secuencia de ADN corriente arriba de un gen para iniciar la transcripción. Sin embargo, a diferencia de las células procariotas, la ARN polimerasa eucariota requiere otras proteínas, o factores de transcripción, para facilitar el inicio de la transcripción. La ARN polimerasa por sí sola no puede iniciar la transcripción en células eucariotas. Hay dos tipos de factores de transcripción que regulan la transcripción eucariota: Factores de transcripción generales (o basales) se unen a la región promotora del núcleo para ayudar con la unión de la ARN polimerasa. Factores de transcripción específicos se unen a varias regiones fuera de la región promotora central e interactúan con las proteínas en el promotor central para potenciar o reprimir la actividad de la polimerasa.

Vea el proceso de transcripción (video): la creación de ARN a partir de una plantilla de ADN.

El promotor y la maquinaria de transcripción

Los genes están organizados para facilitar el control de la expresión genética. La región promotora está inmediatamente aguas arriba de la secuencia codificante. Esta región puede ser corta (solo unos pocos nucleótidos de longitud) o bastante larga (cientos de nucleótidos de longitud). Cuanto más largo sea el promotor, más espacio disponible para que las proteínas se unan. Esto también agrega más control al proceso de transcripción. La longitud del promotor es específica de un gen y puede diferir dramáticamente entre genes. En consecuencia, el nivel de control de la expresión génica también puede diferir de forma bastante drástica entre genes. El propósito del promotor es unir factores de transcripción que controlan el inicio de la transcripción.

Dentro de la región promotora del núcleo, de 25 a 35 bases corriente arriba del sitio de inicio de la transcripción, reside la caja TATA. La caja TATA tiene la secuencia de consenso de 5’-TATAAA-3 ’. La caja TATA es el sitio de unión de un complejo proteico llamado TFIID, que contiene una proteína de unión a TATA. La unión de TFIID recluta otros factores de transcripción, incluidos TFIIB, TFIIE, TFIIF y TFIIH. Algunos de estos factores de transcripción ayudan a unir la ARN polimerasa al promotor y otros ayudan a activar el complejo de iniciación de la transcripción.

Además de la caja TATA, se encuentran otros sitios de unión en algunos promotores. Algunos biólogos prefieren restringir el rango del promotor eucariota al promotor central, o sitio de unión de la polimerasa, y se refieren a estos sitios adicionales como elementos proximales al promotor, porque generalmente se encuentran dentro de unos pocos cientos de pares de bases aguas arriba del sitio de inicio de la transcripción. . Ejemplos de estos elementos son el recuadro CAAT, con la secuencia de consenso 5’-CCAAT-3 ’y el recuadro GC, con la secuencia de consenso 5’-GGGCGG-3 ’. Los factores de transcripción específicos pueden unirse a estos elementos proximales al promotor para regular la transcripción de genes. Un gen dado puede tener su propia combinación de estos sitios de unión de factores de transcripción específicos. Hay cientos de factores de transcripción en una célula, cada uno de los cuales se une específicamente a un motivo de secuencia de ADN particular. Cuando los factores de transcripción se unen al promotor justo corriente arriba del gen codificado, se denomina elemento que actúa en cis, porque está en el mismo cromosoma, justo al lado del gen. Los factores de transcripción responden a estímulos ambientales que hacen que las proteínas encuentren sus sitios de unión e inicien la transcripción del gen que se necesita.

Mejoradores y transcripción

En algunos genes eucariotas, existen regiones adicionales que ayudan a aumentar o mejorar la transcripción. Estas regiones, llamadas potenciadoras, no están necesariamente cercanas a los genes que potencian. Pueden ubicarse corriente arriba de un gen, dentro de la región codificante del gen, corriente abajo de un gen, o pueden estar a miles de nucleótidos de distancia.

Las regiones potenciadoras son secuencias de unión, o sitios, para factores de transcripción específicos. Cuando un factor de transcripción de una proteína se une a su secuencia potenciadora, la forma de la proteína cambia, lo que le permite interactuar con las proteínas en el sitio del promotor. Sin embargo, dado que la región potenciadora puede estar distante del promotor, el ADN debe doblarse para permitir que las proteínas de los dos sitios entren en contacto. Las proteínas que doblan el ADN ayudan a doblar el ADN y unen las regiones potenciadora y promotora ((Figura)). Este cambio de forma permite la interacción de las proteínas activadoras específicas unidas a los potenciadores con los factores de transcripción generales unidos a la región promotora y la ARN polimerasa.


Desactivación de genes: represores transcripcionales

Como las células procariotas, las células eucariotas también tienen mecanismos para prevenir la transcripción. Los represores transcripcionales pueden unirse a regiones promotoras o potenciadoras y bloquear la transcripción. Al igual que los activadores de la transcripción, los represores responden a los estímulos externos para evitar la unión de los factores de transcripción activadores.

Resumen de la sección

Para iniciar la transcripción, los factores de transcripción generales, como TFIID, TFIIB y otros, primero deben unirse a la caja TATA y reclutar ARN polimerasa en esa ubicación. Los factores de transcripción adicionales también pueden unirse a otros elementos reguladores en el promotor para aumentar o prevenir la transcripción. Además de las secuencias promotoras, las regiones potenciadoras ayudan a aumentar la transcripción. Los potenciadores pueden estar aguas arriba, aguas abajo, dentro de un gen mismo o en otros cromosomas. Los factores de transcripción específicos unidos a las regiones potenciadoras pueden aumentar o prevenir la transcripción.

Respuesta libre

Una mutación dentro de la región promotora puede alterar la transcripción de un gen. Describe cómo puede suceder esto.

Una mutación en la región promotora puede cambiar el sitio de unión de un factor de transcripción que normalmente se une para aumentar la transcripción. La mutación podría disminuir la capacidad del factor de transcripción para unirse, disminuyendo así la transcripción, o puede aumentar la capacidad del factor de transcripción para unirse, aumentando así la transcripción.

¿Qué podría suceder si una célula tuviera demasiado factor de transcripción activador presente?

Si estuviera presente demasiado factor de transcripción activador, entonces la transcripción aumentaría en la célula. Esto podría conducir a alteraciones dramáticas en la función celular.

Un científico identifica un sitio de regulación de la transcripción potencial 300 pb aguas abajo de un gen y plantea la hipótesis de que es un represor. ¿Qué experimento (con resultados) podría realizar para apoyar esta hipótesis?

La forma más fácil de probar su hipótesis sería mutar el sitio en una célula y monitorear los niveles de la transcripción de ARNm hecha a partir del gen. Si los niveles de transcripción aumentan en la célula mutada, entonces el sitio reprime la transcripción.

Glosario


IMGT & # 174, el sistema de información internacional ImMunoGeneTics & # 174

La información a proporcionar comprende, para cada gen:
1) el número de acceso público del clon del que se extrajo la secuencia (o de las posiciones y versión del ensamblaje del NCBI), con el nombre del gen propuesto (provisional), las posiciones comienzan y terminan en ese número de acceso,
2) la secuencia correspondiente en formato FASTA:
- para genes V: desde el comienzo de L-PART1 (atg) hasta el extremo 3 'de V-RS
- para genes D: desde el extremo 5 'del 5'D-RS hasta el extremo 3' del 3'D-RS
- para genes J: desde el extremo 5 'de J-RS hasta el extremo 3' de J-REGION
- para genes C: desde el extremo 5 'del primer exón hasta el extremo 3' (codón de terminación) del último exón.
3) la funcionalidad propuesta (F, ORF, P) y comentarios (cualquier comentario que pueda ser útil, por ejemplo, por qué un gen se considera 'ORF' o 'P')
4) además, para los genes V,
- las longitudes de CDR-IMGT (la línea germinal CDR3-IMGT incluye, si está presente, uno o dos nucleótidos aguas arriba del V-HEPTAMER)
- el gen y alelo V-REGION humano más cercano con puntuación, porcentaje de identidad y relación de longitud de alineación, según lo proporcionado por IMGT / V-QUEST.
Para pseudogenes, la información anterior obtenida mediante la opción 'Buscar inserciones y eliminaciones en V-REGION', con un resumen de los defectos fuera del marco (por ejemplo, '1 del (1), 2 ins (1,2) 'para una deleción de 1 nucleótido (nt), 2 inserciones de 1 nt y 2nt).

Números de subgrupos IG y TR

Los números de los subgrupos IG y TR se asignan, siempre que sea posible, en comparación con los Homo sapiens subgrupos (identidad de secuencia de nucleótidos V-REGION> 75% para genes funcionales y ORF y, para información, longitudes de CDR-IMGT). Esto significa que algunos Homo sapiens Los números de subgrupos pueden no estar representados en algunas especies o, a la inversa, pueden agregarse nuevos números para subgrupos no representados en Homo sapiens.

  • & ordm Para el IG, los números de genes indican la localización en el locus, independientemente de los subgrupos. El número de genes aumenta de 3 'en el locus (aguas abajo, junto a los genes D y / o J) a 5' en el locus (aguas arriba).
    Ex: Homo sapiens IG H. http://www.imgt.org/IMGTrepertoire/index.php?section=LocusGenes&repertoire=locus&species=human&group=IGH
  • & ordm Para el TR, los números de genes indican la localización respectiva, en el locus, de genes que pertenecen a un subgrupo dado. El número de genes aumenta para un subgrupo dado de 5 'en el locus (aguas arriba) a 3' en el locus (aguas abajo, junto a los genes D y / o J).
    Ex: Homo sapiens TRB. http://www.imgt.org/IMGTrepertoire/index.php?section=LocusGenes&repertoire=locus&species=human&group=TRB

Lefranc M-P. Inmunoglobulina (IG) y genes receptores de células T (TR): IMGT & reg y el nacimiento y auge de la inmunoinformática. Front Immunol. 2014 de febrero de 055: 22. doi: 10.3389 / fimmu.2014.00022. Acceso abierto. PMID: 24600447 ¿"Parcial en 3" o "Parcial en 5" hace que las secuencias no sean funcionales o es simplemente que la región del gen no se ha secuenciado completamente? "parcial en 3 '" o "parcial en 5'" indica que la región del gen no estaba completamente secuenciada. Hay algunas secuencias que están marcadas con "F" pero terminan en un codón de terminación. ¿Son estos funcionales? Cuando existe una alta probabilidad de que el codón de terminación sea recortado y reemplazado por una región N durante el reordenamiento V- (D) -J, el gen se considera funcional. ¿Qué significa 'OR9' en algunos genes TRBV de Homo sapiens? 'OR9' en el nombre del gen IMGT indica que este gen es un orphon 'OR', ubicado en el cromosoma 9.
Un orphon es un gen identificado en una ubicación cromosómica fuera de los loci principales y que, por lo tanto, no puede participar en la síntesis de la cadena IG o TR in vivo.
http://www.imgt.org/IMGTindex/orphon.php
http://www.imgt.org/IMGTScientificChart/Nomenclature/IMGTnomenclature.html
En IMGT / V-QUEST, los orphons se excluyen de 'F + ORF + in-frame P' (usado, por ejemplo, para análisis de repertorio) pero se pueden buscar si es relevante (por ejemplo, para análisis genómico) usando las opciones 'incluyendo orphons 'en Parámetros avanzados. ¿Qué sucede si hay un codón de parada en una secuencia líder? Un codón de terminación en la secuencia líder hace que un gen o un alelo sea pseudogén. Este es el caso de la Homo sapiens Alelo IGKV1-39 * 02 que se indica como 'P' (pseudogén) en la tabla de genes Homo sapiens IGKV: http://www.imgt.org/IMGTrepertoire/index.php?section=LocusGenes&repertoire=genetable&species=human&group=IGKV Tal alelo o gen puede ser transcrito (y por lo tanto se encuentra en la secuenciación 5'RACE / NGS) pero no se traduce in vivo. ¿Cómo recuperar la secuencia de nucleótidos de los genes IG y / o TR sin intrones? La secuencia de nucleótidos de los genes IG y / o TR sin intrones se puede recuperar de los 'conjuntos empalmados artificialmente' en la página: http://www.imgt.org/vquest/refseqh.html#VQUEST ¿Hay diferencias en la secuencia de nucleótidos en los EX4 tenido en cuenta en la asignación de los alelos TRAC y TRDC? En la asignación de los alelos TRAC y TRDC [1], las diferencias de secuencia de nucleótidos en el EX4 + 3'UTR no traducido (Figura 7 páginas 34-35 [2]) (etiqueta IMGT EX4UTR), no se consideran para la asignación del TRAC y alelos TRDC.
Un alelo TRAC dado o un alelo TRDC (por ejemplo, Homo sapiens TRAC * 01) de diferentes fuentes pueden, por tanto, mostrar pequeñas diferencias en el EX4UTR.
Más información:
[1] Lefranc M-P. Inmunoglobulina (IG) y genes receptores de células T (TR): IMGT & reg y el nacimiento y auge de la inmunoinformática. Front Immunol. 2014 de febrero de 055: 22. doi: 10.3389 / fimmu.2014.00022. Acceso abierto. PMID: 24600447.
[2] Lefranc, M.-P. y Lefranc, G., The T cell receptor FactsBook, Academic Press, 398 páginas (2001) ISBN: 0124413528. Cima

& # 169 Copyright 1995-2021 IMGT & # 174, el sistema de información internacional ImMunoGeneTics & # 174 | Condiciones de uso | Sobre nosotros | Contacta con nosotros | Citando IMGT


Agentes etiológicos de enfermedades infecciosas

Diagnóstico de laboratorio

Reacción en cadena de la polimerasa

La PCR que utiliza cebadores que identifican secuencias conservadas en la región no codificante 5 'del genoma del enterovirus es más sensible que el cultivo para la identificación de enterovirus en LCR, secreciones del tracto respiratorio y orina. 14.152.153 La PCR también se ha utilizado para detectar ARN enteroviral en tejido cardíaco de pacientes con miocarditis66, aunque la sensibilidad y especificidad relativas de la técnica en estos pacientes no están definidas. La prueba de PCR de muestras fecales ha tenido menos éxito debido a la presencia de sustancias que inhiben el paso de polimerización.

Aislamiento de virus

El aislamiento de virus en cultivo celular sigue siendo un método importante de diagnóstico de laboratorio. El éxito del aislamiento varía ampliamente entre las clases de enterovirus y entre los serotipos dentro de una clase. Generalmente, se deben usar tres o cuatro líneas celulares de primates para apoyar el aislamiento de la mayoría de los enterovirus. El efecto citopático suele ser evidente entre 2 y 5 días después de la inoculación de las monocapas celulares. Una vez aislado, el serotipo del virus puede identificarse para la mayoría de los enterovirus comunes con el uso de combinaciones de antisuero equino de intersección de Lim Benyesh-Melnick o mediante secuenciación de ARN. El método óptimo para el aislamiento de los coxsackievirus del grupo A es la inoculación en ratones recién nacidos.

Un diagnóstico etiológico se confirma mediante el aislamiento del virus del LCR, líquido pericárdico, tejido o sangre. La oportunidad de recuperar un virus en cultivo celular se optimiza tomando muestras de varios sitios. El aislamiento del virus de las heces es menos definitivo porque pueden ocurrir infecciones asintomáticas intercurrentes no relacionadas. Sin embargo, debido a que la tasa básica de diseminación del tracto gastrointestinal es baja, el aislamiento de enterovirus de cualquier sitio es una fuerte evidencia presuntiva de causalidad.

Serología

La prueba de microneutralización es el método más utilizado para la determinación de anticuerpos contra enterovirus. Este ensayo específico de serotipo tiene una utilidad limitada en el diagnóstico de rutina de infecciones por enterovirus no polio porque no es factible incorporar todos los antígenos virales vivos relevantes en el ensayo y los métodos basados ​​en la neutralización son relativamente insensibles, poco estandarizados y laboriosos. Los inmunoensayos específicos de tipo ahora están disponibles comercialmente para medir anticuerpos contra los serotipos de enterovirus más comunes, pero a menudo no están bien estandarizados. El anticuerpo IgM en suero se ha detectado temprano en el curso de la infección por coxsackievirus del grupo B, echovirus 30 y enterovirus 70. Sin embargo, los ensayos de IgM para enterovirus no son específicos del serotipo 154,155 y parecen carecer de sensibilidad. 156


Materiales y métodos

RT-PCR y construcciones de plásmidos.

Para la RT-PCR, se extrajo el ARN total de las células inyectadas y se analizó utilizando transcriptasa inversa M-MLV (Invitrogen) y polimerasa HiFi Taq (Invitrogen) de acuerdo con el protocolo del fabricante. Las reacciones de PCR se llevaron a cabo usando pares de cebadores específicos de genes, Ftz-127F y Ftz-444R (ver Figura 1A), y para los controles, usamos 18S rRNA-448F de ratón y 18S rRNA-926R de ratón.

Las construcciones ftz se modificaron para generar t-ftz-i (Figura 1A y Figura S1), t-ftz-Δi y sus derivados (Figura S3). Para los experimentos de expresión en mamíferos in vivo, las construcciones t-ftz se digirieron con HindIII y XhoI, y luego se ligaron en el vector de expresión pcDNA3. Se amplificó el ADNc de insulina humana a partir de una biblioteca de ADNc y se amplificó el gen de la insulina a partir del ADN genómico de HeLa utilizando pares de cebadores específicos de genes digeridos con HindIII y XhoI, y luego se ligó en el vector de expresión pcDNA3. La insulina se modificó con cebadores de PCR para generar insulina 5A (ver Figura S3).

Síntesis, purificación y traducción in vitro de ARN.

La transcripción in vitro se llevó a cabo utilizando el kit de transcripción T7 mMESSAGE mMACHINE que contiene el exceso de tapa (Ambion). Para sintetizar ARNm con análogos cap, la reacción se llevó a cabo con ApppG 35 mM o 3mGpppG (New England Biolabs) ATP, UTP y CTP 10 mM y GTP 1 mM. Las transcripciones se poliadenilaron utilizando el kit de colas de poli (A) (Ambion), lo que generó colas de poli (A) de 200 a 300 nucleótidos. La purificación del ARNm se llevó a cabo usando el kit MEGAclear (Ambion). A continuación, se precipitó el ARNm con acetato de potasio 150 mM (pH 5,5) y 2,5 volúmenes de etanol al 100%. El ARNm se resuspendió en tampón de inyección (KCl 100 mM, HEPES 10 mM, pH 7,4). Los ARNm se tradujeron en un sistema de lisado de reticulocitos TnT en presencia de 35 S-metionina (Promega).

Cultivo celular, transfección de ARNip y ADN y microinyección.

Los fibroblastos NIH 3T3 se mantuvieron en DMEM suplementado con suero bovino al 10%. Las células HeLa y COS-7 se mantuvieron en DMEM suplementado con suero bovino fetal al 10%. Las células se sembraron durante la noche en placas de 35 mm de diámetro con fondos de cubreobjetos de vidrio (MatTek Corp.). For RNAi experiments, HeLa cells were transfected with siRNA directed against human UAP56 and URH49 [45] or eIF4AIII [59]. 24 and 48 h post transfection, cells were either plated on 35-mm dishes (for microinjections) or collected to assess protein levels by SDS-PAGE and Western blot with rabbit anti-UAP56 serum [4], rabbit anti-eIF4AIII [59], or rabbit anti-CBP80 serum [3]. For DNA transfections, cells were transfected with DNA and lipofectamine (Invitrogen) using the manufacture's protocol.

Microinjections were performed as previously described [60]. mRNA was microinjected at 200 μg/ml along with fluorescein isothiocyanate (FITC)–conjugated 70-kDa dextran (1 mg/ml Invitrogen). Insulin mRNA was heated to 70 °C for 10 min prior to injections. DNA was injected at 50 μg/ml along with FITC-conjugated 70-kDa dextran, and translation was inhibited with 50 μg/ml α-amanitin (Sigma). For export inhibition experiments, cells were first microinjected with WGA (3 mg/ml Sigma) or CTE RNA (200 μg/ml) along with cascade-blue–conjugated 10-kDa dextran (Invitrogen), and then incubated for 30 min at 37 °C prior to mRNA microinjection. For azide treatments, microinjected cells were washed three times with Dulbecco's modified PBS (D-PBS 10 mM phosphate, pH 7.4, 140 mM NaCl, 3 mM KCl, 0.8 mM CaCl2, 0.7 mM MgCl2) and incubated in D-PBS supplemented with 10 mM azide (Sigma) or 10 mM D-glucose (Sigma). For pactamycin treatments, cells were incubated in DMEM (10% fetal bovine serum) with 200 nM pactamycin 20 min before microinjections.

Immunostaining and FISH.

Microinjected cells were washed with D-PBS, fixed in 4% paraformaldehyde (Electron Microscope Sciences) in D-PBS, and permeabilized with 0.1% Triton X100 (Peirce) in PBS. For immunostaining, fixed samples were first incubated with primary antibodies (rabbit polyclonal against TRAPα [61], goat polyclonal antibody against TIA-1 [Santa Cruz Biotechnology], 12CA5 monoclonal antibody against HA [Roche Applied Sciences], and M2 monoclonal antibody against FLAG [Sigma]) diluted 1:200 in immunostain solution (PBS, 0.1% Triton X100, 2 mg/ml RNAse free BSA Ambion) for 30 min, washed three times with PBS, and incubated with various Alexa-conjugated secondary antibodies (Invitrogen), diluted 1:200 in immunostain solution. For FISH, fixed cells were washed with 50% formamide in 1X SSC (150 mM NaCl, 15 mM NaCitrate, pH 7.10) and then incubated overnight at 37 °C in 200-ml hybridization buffer (50% formamide, 100 mg/ml dextran sulphate, 0.02 mg/ml RNAse free BSA, 1 mg/ml Escherichia coli tRNA, 5 mM VRC, 1X SSC) containing 30–50 ng oligonucleotide probe (GTCGAGCCTGCCTTTGTCATCGTCGTCCTTGTAGTCACAACAGCCGGGACAACACCCCAT for ftz, GGTCCTCTGCCTCCCGGCGGGTCTTGGGTGTGTAGAAGAAGCCTCGTTCCCCGCACACTA for insulin) labeled at their 5′ end with Alexa-546 (Integrated DNA Technologies). Cells were washed in five times with 50% formamide in 1X SSC and images were captured using an EM-CCD Camera, Model C9100–12 (Hamamatsu) on an inverted microscope (200M, Carl Zeiss) using Metamorph software (Molecular Devices Corporation). Unaltered 14-bit images were quantified in Metamorph and analyzed in Excel (Microsoft). For each image the area (A) and the average intensity (I) of each injected nuclei (norte) and cell body (B) were recorded. For the background intensity, the average intensity of an un-injected cell (tu) se utilizó. The cytoplasmic fluorescence was equal to (Ab)(IbIu) – (Un)(EnIu). The ratio of cytoplasmic/total fluorescence equals [(Ab)(IbIu) – (Un)(EnIu)]/[(Ab)(IbIu)]. For figure production, the contrast and brightness of the aquired 14-bit micrographs were adjusted to optimize the ability to view the fluorescence. The resulting images were converted to 8-bit files using Metamorph.


Ver el vídeo: Webinar: Retrieving Exon and Coding Region Sequences for Genes (Mayo 2022).


Comentarios:

  1. Floyd

    Gracias por tu ayuda en este asunto. No sabía eso.

  2. Hampton

    Bien hecho, la respuesta es excelente.

  3. Montaro

    Vamos, inventado, no inventado, todo es divertido temprano.

  4. Kajora

    Estoy absolutamente seguro de eso.

  5. Bilagaana

    es la frase de valor

  6. Froille

    Bravo, tu pensamiento es genial.



Escribe un mensaje