Información

Resonancia de plasma de superficie (SPR) ¿Predice el límite de peso molecular?

Resonancia de plasma de superficie (SPR) ¿Predice el límite de peso molecular?



We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Solo preguntando, ¿podemos predecir cómo el analito de bajo peso molecular (LMW) puede detectar nuestro sistema SPR en función de nuestro LOD (límite de detección) y nuestra sensibilidad en la detección de otra proteína? Entonces, en este momento, nuestro sistema desarrollado puede detectar alfa-sinucleína (14 kDa) con un LOD de alrededor de 5 fg / ml. ¿Podemos predecir cómo podemos detectar LMW? ¿Hay algún documento de referencia o algo así? Porque hasta donde yo sé, podemos obtener el cambio de RII basado en los experimentos primero. Pero en este momento mi caso es que quiero probar el límite de nuestros dispositivos SPR para detectar LMW (estoy eligiendo qué analitos LMW comprar ahora)

¡Gracias! cualquier discusión o comentario es muy apreciado


Sensores de resonancia de plasmón de superficie en biología celular: conceptos básicos y aplicación

Los sensores ópticos basados ​​en la excitación de plasmones de superficie, denominados sensores de resonancia de plasmones de superficie (SPR), se han convertido en una herramienta analítica central para caracterizar y cuantificar una amplia variedad de interacciones macromoleculares, como los contactos entre receptor y ligando. Además de este campo de aplicación clásico, en los últimos 15 años, el desarrollo de sensores SPR destinados a la detección y análisis de interacciones ligando / célula o huésped / patógeno, contactos célula / célula y reacciones celulares ganó un impulso considerable. El número de publicaciones que informan sobre aplicaciones de sensores SPR que implementan células procariotas o eucariotas vitales como elementos de biorreconocimiento para diagnósticos médicos, monitoreo ambiental o seguridad biológica está creciendo constantemente. Esta revisión ofrece una breve introducción a la técnica de resonancia de plasmón de superficie y los parámetros que son importantes para su aplicación en el campo de los sensores de células vitales. Además, se resumen las publicaciones relativas a la aplicación de dichos sensores en el análisis de interacciones celulares y reacciones celulares a estímulos extra e intracelulares.

Esta es una vista previa del contenido de la suscripción, acceda a través de su institución.


Abstracto

Las moléculas pequeñas son difíciles de detectar directamente utilizando instrumentos de resonancia de plasmón superficial (SPR) disponibles comercialmente. Esto se debe a que los compuestos de bajo peso molecular no tienen suficiente masa para provocar un cambio medible en el índice de refracción. Sin embargo, el índice de refracción es sensible a otras propiedades además de la masa del analito. Recientemente se ha informado de la detección de cambios conformacionales sustanciales para proteínas inmovilizadas usando SPR. Sin embargo, esta propiedad aún no se ha aprovechado para la detección de la unión de ligandos de bajo peso molecular a receptores de proteínas inmovilizados. Aquí demostramos que los cambios conformacionales inducidos por ligando pueden usarse para monitorear la unión de moléculas pequeñas a la proteína de unión a maltosa inmovilizada y la transglutaminasa tisular. La unión del ligando a un receptor que disminuye en el radio hidrodinámico produjo una disminución neta en el índice de refracción. Se observó un cambio neto positivo en el índice de refracción para un receptor que aumenta en el radio hidrodinámico. Los cambios del índice de refracción no pudieron explicarse mediante la adición de masa molecular del analito a la superficie. Estas respuestas de SPR fueron el resultado de interacciones receptor-ligando específicas, a juzgar por la reversibilidad de la respuesta y las similitudes entre las constantes de disociación de equilibrio determinadas por SPR y las constantes de disociación informadas. Además, esta técnica demostró ser eficaz para detectar ligandos específicos de un panel de moléculas pequeñas. Este método SPR no requirió alteraciones en la instrumentación ampliamente utilizada y disponible comercialmente, pero permitió la detección directa de moléculas muy pequeñas como los iones de calcio (40 Da). El uso de la conformación del receptor para detectar analitos de bajo peso molecular tiene aplicaciones potenciales en el cribado de alto rendimiento de bibliotecas de fármacos de moléculas pequeñas y el desarrollo de biosensores.

Dirección actual: Departamento de Bioquímica, Universidad de Wisconsin, Madison, Madison, WI 53706.

Autor para correspondencia: (correo electrónico) [correo electrónico & # 160 protegido] (fax) 919-597-6400.


Abstracto

Las moléculas pequeñas son difíciles de detectar directamente utilizando instrumentos de resonancia de plasmón superficial (SPR) disponibles comercialmente. Esto se debe a que los compuestos de bajo peso molecular no tienen suficiente masa para provocar un cambio medible en el índice de refracción. Sin embargo, el índice de refracción es sensible a otras propiedades además de la masa del analito. Recientemente se ha informado de la detección de cambios conformacionales sustanciales para proteínas inmovilizadas usando SPR. Sin embargo, esta propiedad aún no se ha aprovechado para la detección de la unión de ligandos de bajo peso molecular a receptores de proteínas inmovilizados. Aquí demostramos que los cambios conformacionales inducidos por ligando pueden usarse para monitorear la unión de moléculas pequeñas a la proteína de unión a maltosa inmovilizada y la transglutaminasa tisular. La unión del ligando a un receptor que disminuye en el radio hidrodinámico produjo una disminución neta en el índice de refracción. Se observó un cambio neto positivo en el índice de refracción para un receptor que aumenta en el radio hidrodinámico. Los cambios del índice de refracción no pudieron explicarse mediante la adición de masa molecular del analito a la superficie. Estas respuestas de SPR fueron el resultado de interacciones receptor-ligando específicas, según se juzga por la reversibilidad de la respuesta y las similitudes entre las constantes de disociación de equilibrio determinadas por SPR y las constantes de disociación informadas. Además, esta técnica demostró ser eficaz para detectar ligandos específicos de un panel de moléculas pequeñas. Este método SPR no requirió alteraciones en la instrumentación ampliamente utilizada y disponible comercialmente, pero permitió la detección directa de moléculas muy pequeñas como los iones de calcio (40 Da). El uso de la conformación del receptor para detectar analitos de bajo peso molecular tiene aplicaciones potenciales en el cribado de alto rendimiento de bibliotecas de fármacos de moléculas pequeñas y el desarrollo de biosensores.

Dirección actual: Departamento de Bioquímica, Universidad de Wisconsin, Madison, Madison, WI 53706.

Autor para correspondencia: (correo electrónico) [correo electrónico & # 160 protegido] (fax) 919-597-6400.


Materiales y métodos

Recolección de muestras y aislamiento de linfocitos.

Se recogió sangre en viales de ácido etilendiaminotetraacético (EDTA) (Venoject K2E, Lovaina, Bélgica) de un donante que se curó de periodontitis después del tratamiento (Centro de Rehabilitación Oral, Atención de Salud Dental Pública, Consejo del Condado de Östergötland, Linkoping, Suecia). La sangre completa se diluyó en una solución de NaCl al 0,9% en una proporción de 1: 1 y se colocó cuidadosamente en capas sobre 6,0 ml de solución de linfoprep (Axis-shield PoC, Oslo, Noruega) en dos tubos Ficoll (Thermofischer Scientific Inc., Estocolmo, Suecia) para centrifugación en gradiente a 1800 gramo a 20 ° C durante 20 min. Se pipeteó cuidadosamente una capa clara de linfocitos y se lavó con solución salina tamponada con fosfato (PBS pH 7,2 Apoteket AB, Linkoping, Suecia). Las células se cultivaron en medio 1-15 que contenía l -glutamina (ATCC, Boras, Suecia), suplementado con suero bovino fetal al 10% (FBS Sigma-Aldrich, Estocolmo, Suecia) y se incubaron a 37 ° C durante la noche.

El comité ético regional de Linköping aprobó el estudio (2010 / 307-31), y todos los pacientes que participaron en nuestro estudio fueron informados con su consentimiento.

Cultivo bacteriano y estimulación de linfocitos.

Porphyromonas gingivalis ATCC 33277 de tipo salvaje (American Type Culture Collection, Manassas, VA), W 50 de tipo salvaje, E8 (deficiente en RgpA derivado de W50 y deficiente en RgpB) y K1A (deficiente en Kgp derivado de W50) (proporcionado amablemente por el Prof. MA Curtis, Molecular Pathogenesis Group, Queen Mary, Universidad de Londres, Reino Unido), tipo salvaje 381, DPG-3 (381 derivado de Fim A deficiente) y KRX-178 (381 derivado de Mfa-1 deficiente) (proporcionado amablemente por el Prof. RJ Genco, Departamento de Microbiología e Inmunología, Universidad de Buffalo, NY) se cultivaron en caldo anaerobio exigente (29,7 g / L, pH 7,2) en condiciones anaeróbicas (80% N2, 10% CO2y 10% H2) a 37 ° C en una cámara (Concept 400 Anaerobic Workstation Ruskinn Technology Ltd., Leeds, Reino Unido). Las bacterias se lavaron y se resuspendieron en tampón de glucosa de Krebs-Ringer (NaCl 120 mM, KCl 4,9 mM, MgSO 1,2 mM4, 1,7 mM KH2correos4, Na 8,3 mM2HPO4y glucosa 10 mM, pH 7,3).

Muerto por calor PAG. gingivalis se preparó mediante incubación a 80 ° C durante 20 min. Se esparció un total de 10 μL de la suspensión muerta por calor en una placa de agar anaerobio exigente para asegurar que las bacterias murieron y se incubaron a 37 ° C durante 5 días. Muerto por calor PAG. gingivalis Se utilizó ATCC 33277, 109 ufc / ml para estimular los linfocitos y se incubó a 37ºC. El medio fresco se complementó a intervalos regulares hasta los 21 días.

Análisis de citometría de flujo de linfocitos

Se realizó un análisis de citometría de flujo para estudiar la composición celular. Las células se centrifugaron a 300ºC. gramo (Eppendorf Centrifuge 5702R5, Alemania) durante 5 min, y el sedimento se disolvió en 1000 μL de PBS al descartar el sobrenadante. La composición celular se determinó mezclando 100 μL de la muestra con 20 μL de cóctel de anticuerpos de marcadores de superficie CD19, CD3, CD16 / 56 y CD45 marcados con los fluorocromos aloficocianina (APC), isotiocianato de fluoresceína (FITC), ficoeritrina (PE) y Complejo proteico de clorofila de peridinina (PerCP) (BD Biosciences, Estocolmo, Suecia) y se incubó durante 15 min en la oscuridad. Los glóbulos rojos se lisaron añadiendo 450 µl de solución de lisis (suero de ternero fetal al 2% (FCS Sigma-Aldrich, Estocolmo, Suecia), solución de azida sódica al 0,1% en PBS pH 7,4). Después de 15 min de incubación, las células se analizaron en BD FACS Canto (BD Biosciences, Estocolmo, Suecia). Los resultados se representaron en una escala logarítmica mediante la activación de células de linfocitos CD45 + para su análisis. Las células se analizaron 1 semana después de la estimulación con bacterias, mientras que las células no estimuladas se analizaron después de 3 días. Los linfocitos no estimulados después de 3 días no contenían suficientes recuentos de células para un análisis adicional debido a la ausencia de un agente activador. Por lo tanto, se aislaron y cultivaron linfocitos de la sangre del mismo paciente, como se describió anteriormente, tres días antes del análisis de citometría de flujo.

Tinción inmunofluorescente y microscopía confocal

Las suspensiones celulares estimuladas por 2 y 3 semanas de incubación se centrifugaron a 170ºC. gramoy el sedimento se disolvió en 2 ml de medio 1-15 nuevo que contenía FBS al 10%. A continuación, se citocentrifugó un total de 200 μL de 5 x 105 células / ml de suspensión a 600 rpm durante 6 min. Se utilizó paraformaldehído (4%) para fijar las células durante 2 ha temperatura ambiente. Las células fijadas se lavaron cuatro veces con PBS a intervalos de 5 min de incubación, se bloquearon usando FBS al 5% durante 1 ha temperatura ambiente y luego se lavaron nuevamente usando el mismo protocolo. Las células se incubaron con anticuerpos anti-CD38 humano (BD Biosciences, Estocolmo, Suecia diluido 1: 100) durante la noche a 4ºC. Las células se lavaron con PBS como antes y luego se incubaron con anticuerpos anti-ratón de cabra conjugados con isotiocianato de fluoresceína durante 2 ha temperatura ambiente. Las células se lavaron cuatro veces con PBS y luego se contratiñeron con una dilución 1: 200 de 4ʹ, 6-diamidino-2-fenilindol (DAPI) (Sigma-Aldrich, Estocolmo, Suecia) durante 3 min. Después de lavar cuatro veces, las células se analizaron en un microscopio confocal Zeiss de microdisección de captura con láser (LCM) (Departamento de Patología, Universidad de Linköping, Suecia).

Recuperación de anticuerpos

Después de 3 semanas, el medio de cultivo se transfirió a tubos de centrífuga estériles de 15 ml (Greiner Bio-One, Alemania) y se centrifugó a 3500ºC. gramo durante 10 min para sedimentar las células. El sobrenadante se filtró utilizando filtros estériles de 0,45 µm (Thermofisher Scientific, Estocolmo, Suecia) y se centrifugó utilizando filtros de corte microcon 100 KDa Amicon (Millipore, Molsheim, Francia) a 3500 gramo durante 60 min. El sobrenadante que contiene anticuerpos contra PAG. gingivalis con un peso molecular & gt100 KDa, y el estéril se filtró con filtros estériles de 0,2 µm (Thermofisher Scientific, Estocolmo, Suecia) para ser almacenado a -50 ° C.

Electroforesis en gel de poliacrilamida con dodecil sulfato de sodio

Se realizó una electroforesis estándar en gel de poliacrilamida con dodecilsulfato de sodio para visualizar la interacción antígeno-anticuerpo como un método alternativo para mostrar la especificidad de los anticuerpos frente a los antígenos. Muerto por calor PAG. gingivalis, que se utilizó para estimular los linfocitos del huésped, se incubó con ambos anti-PAG. gingivalis anticuerpos producidos in vitro y anti-Escherichia coli anticuerpos (Swed Diagnostics, Estocolmo, Suecia).

Todas las muestras preparadas se diluyeron en una proporción de 1: 4 con PBS (pH 7,4, Sigma-Aldrich, Estocolmo, Suecia) y se centrifugaron a 3450ºC. gramo durante 10 min después de 24 h de incubación. Los sobrenadantes se centrifugaron en filtros centrífugos de 100 KDa (Millipore, Estocolmo, Suecia) y se calentaron con un volumen igual de tampón Laemmli durante 5 min. Las muestras se procesaron en geles prefabricados TGX de electroforesis en gel de poliacrilamida y dodecilsulfato de sodio (Bio-rad, Estocolmo, Suecia).

Ensayo de subclase de IgG

El análisis de subclases de IgG se realizó sobre los anticuerpos producidos in vitro utilizando un kit ELISA. Las placas de ELISA prerrevestidas y los reactivos se prepararon de acuerdo con las instrucciones del fabricante. Anticuerpos in vitro producidos contra PAG. gingivalis se diluyeron con diluyente ELISA en una proporción de 1: 4. Se usó una solución de peroxidasa anti-IgG humana como anticuerpo secundario, y se usó una solución de sustrato de 3,3ʹ, 5,5ʹ-tetrametilbencidina para la reacción cromógena. Los resultados se leyeron a 450 nm dentro de una hora después de agregar la solución de parada en un microlector de ELISA (lector de ELISA Expert 96, GmBH, Austria). El suero humano proporcionado por el fabricante se utilizó como control y las concentraciones se calcularon a partir de los estándares.

Resonancia de plasmones superficiales

Anti-PAG. gingivalis Los anticuerpos se inmovilizaron en un chip sensor CM 5 de un Biacore® 1000 (GE Healthcare Ltd, Suecia) para investigar interacciones específicas antígeno-anticuerpo utilizando el método de acoplamiento de amina. La inmovilización se llevó a cabo en tres pasos. Primero, la superficie del canal recubierta de dextrano carboximetilado en el chip se activó inyectando un norte-hidroxisuccinimida y norteMezcla de hidrocloruro de etil-Nʹdimetil aminopropilcarbonamida (GE Healthcare Ltd, Suecia) (proporción 1: 1). Anti-PAG. gingivalis los anticuerpos se diluyeron con acetato (pH 4,5), que se une a la superficie activada del chip en la inyección. Finalmente, la superficie del sensor se desactivó inyectando 70 μL de etanolamina (GE Healthcare Ltd, Suecia), evitando la unión de otras partículas a la superficie del sensor.

Los anticuerpos inmovilizados se probaron realizando controles positivos y negativos. IgG antihumana (Sigma-Aldrich, St Louis, MO) y muerta por calor PAG. gingivalis utilizados para estimular los linfocitos anteriormente se utilizaron como controles positivos. Varias cepas bacterianas ATCC (CCUG, Gothenberg, Suecia) e IgG anti-cobaya (Sigma-Aldrich) se utilizaron como controles negativos. La respuesta obtenida con SPR se midió en RU utilizando el software de evaluación Bia (GE Healthcare Ltd., Suecia).

Detección de Porphyromonas gingivalis in vitro y en muestras clínicas

Se recolectaron muestras de plasma de donantes de sangre sanos y se incubaron con 108 ufc / ml de mutantes de tipo salvaje y fimbrias de PAG. gingivalis. Las muestras se diluyeron 1:20 en PBS 7.4 (Sigma-Aldrich, Estocolmo, Suecia) y un conjunto de estos se incubó con anti-PAG. gingivalis anticuerpos durante la noche. Las muestras, con y sin incubación de anticuerpos, se procesaron en el chip inmovilizado con anti-PAG. gingivalis anticuerpos a una velocidad de flujo de 5 μL / min.

Se recolectaron muestras de líquido crevicular gingival (GCF) de los pacientes (norte = 30) con periodontitis grave no tratada en el Departamento de Periodoncia, Centro de Rehabilitación Oral en Linköping, Suecia, y de un grupo de controles periodontalmente sanos de la misma edad y sexo (norte = 30).

Las muestras se obtuvieron de la bolsa periodontal más profunda en cada cuadrante o del sitio mesial de todos los primeros premolares en sujetos de control sin bolsas profundas. La placa supragingival se eliminó sin contaminación salival y el diente se dejó secar al aire. Se insertaron tiras de papel periódico a una profundidad de aproximadamente 1-2 mm subgingivalmente para recolectar GCF, y el volumen de GCF absorbido por las tiras se determinó usando un Periotron 8000 (Oraflow Inc, NY), que se calibró como se describió anteriormente (Chapple et al.., 1999). Se combinó GCF de cuatro tiras de periopapel por paciente en tampón diluyente (inmunoensayo Quantikine Human HGF, R&D Systems, Minneapolis, MN) y se congeló a -20ºC hasta su uso.

Las muestras se descongelaron antes de su uso y se diluyeron en una proporción 1:20 con PBS estéril (Sigma-Aldrich, Estocolmo, Suecia). Las muestras se procesaron en el chip inmovilizado con anti-PAG. gingivalis anticuerpos a una velocidad de flujo de 5 μL / min.

Análisis de hibridación de tablero de ajedrez de ADN-ADN

Se recolectaron muestras microbianas subgingivales de los mismos cuatro sitios que el muestreo de GCF. Se eliminó la placa supragingival y se dejó secar al aire la superficie de la raíz. La muestra bacteriana se recogió insertando una punta de papel endodóntico estéril insertado en la bolsa periodontal que se utilizó para recolectar muestras bacterianas subgingivales de los mismos cuatro sitios donde se recogió GCF durante 20 segundos, que luego se transfirió a un tubo de ensayo estéril. Las muestras se procesaron en el Departamento de Microbiología e Inmunología Oral de la Universidad de Gotemburgo, Suecia, y se analizaron para determinar la presencia PAG. gingivalis, utilizando la técnica de hibridación de tablero de ajedrez de ADN-ADN con un límite de detección de al menos 10,000 células (Socransky et al.., 1994). Las muestras también se incluyeron en nuestros estudios anteriores (Lonn et al.., 2014 ).

Reacción en cadena de la polimerasa en tiempo real

Se realizó un análisis de PCR en tiempo real para validar el método de análisis SPR de detección de PAG. gingivalis en muestras de GCF. Se eligieron muestras que mostraron diferentes respuestas en el análisis de tablero de ajedrez de ADN-ADN y en los métodos SPR y se compararon con los controles sanos. PAG. gingivalis Se utilizó la secuencia del cebador directo de ARNr 16S de TGTAGATGACTGATGTGTAAAACC y la secuencia del cebador inverso de ACGTCATCCCCACCTTCCTC. Se usó SYBR Green (Maxima® SYBR Green / ROX qPCR Master Mix, Fermentas, Suecia) y las condiciones de PCR se establecieron en desnaturalización inicial a 95 ° C durante 10 min, seguido de 95 ° C, 15 seg durante 40 ciclos, y luego 60 ° C, 60 s en un instrumento de PCR en tiempo real 7900 HT (Applied Biosystems).

Microscopio de transmisión por electrones

Se realizó microscopía electrónica de transmisión para estudiar la afinidad de unión de anti-PAG. gingivalis para PAG. gingivalis. PAG. gingivalis diluido 1:20 en PBS se incubó con anti-PAG. gingivalis anticuerpos diluidos 1: 100 en PBS. El exceso de anticuerpos se eliminó mediante lavado con PBS y se añadió anti-IgG humana marcada con oro en una proporción de 1: 1000 (Nano Gold Probes, NY). La mezcla se incubó a 37 ° C durante 1 h. Los anticuerpos en exceso se lavaron con PBS y se fijaron con tetróxido de osmio al 1% (Sigma-Aldrich, Estocolmo, Suecia) hasta que se montaron en una rejilla de cobre revestida con formvar de malla de 200 µm (Agar Scientific, Stansted, Reino Unido). Se usó acetato de uranilo (2%, Sigma-Aldrich, Estocolmo, Suecia) para la tinción antes de examinarlo en un microscopio electrónico de transmisión JEOL 1230 (Departamento de Patología, Universidad de Linkoping, Suecia).

Análisis estadístico

Se realizó un análisis de chi cuadrado para comparar los resultados obtenidos de los dos métodos de análisis SPR y análisis de tablero de ajedrez de ADN-ADN, análisis SPR y PCR de transcripción inversa (RT-PCR) utilizando Graph pad prism, versión 5.0 (GraphPad Software, Inc. , California, EE.UU). De la tabla de distribución de chi cuadrado para el grado de libertad 1 y PAG & gt 0.05 se consideró como un rechazo de la hipótesis nula (Fisher RAaY, 1963) sin diferencias significativas entre los resultados obtenidos por los dos métodos analizados.


Resonancia de plasma de superficie (SPR) ¿Predice el límite de peso molecular? - biología

La resonancia de plasmón de superficie (SPR) es un fenómeno por el cual los fotones se hacen para acoplar energía a una onda de densidad de electrones de superficie que viaja en una interfaz metal-dieléctrica. El acoplamiento se produce con una energía y un momento específicos, denominados colectivamente condición de resonancia, lo que provoca una caída en la luz reflejada. Las características de la inmersión son una función de las propiedades del material en la interfaz, por lo tanto, la monitorización de la inmersión proporciona información sobre el entorno de la superficie local. Los últimos años han visto un impulso en la tecnología SPR hacia la miniaturización, mayor sensibilidad, alto rendimiento y enfoques multimodales. Esta tesis se centra en dos métodos para mejorar el rendimiento de los biosensores SPR. Primero, la sensibilidad de SPR se mejora mediante el uso de una estructura de banda prohibida de plasmón superficial. Se muestra aquí que el funcionamiento de un biosensor SPR en modo de interrogación angular cerca del borde de dicha banda prohibida dará como resultado un aumento de seis veces en la sensibilidad en comparación con SPR en una superficie metálica plana en las mismas condiciones. En segundo lugar, se muestra un método para mejorar el límite de detección utilizando una nueva técnica de análisis de datos basada en el procesamiento de imágenes. Se utiliza una técnica de interrogación de plasmones de superficie multimodal para crear una imagen 2-D de la dispersión espectro-angular de una superficie que luego se utiliza para extraer información sobre el entorno de la superficie utilizando una técnica de análisis de vectores propios desarrollada para explotar la información espectro-angular. El uso de la nueva técnica de vector propio, designada como el método de proyección doble (DPM), en los datos espectro-angulares da como resultado estimaciones del índice de refracción en un amplio rango dinámico con un límite de detección teórico de 5x10-9 unidades de índice de refracción (RIU) que es superior a los métodos actuales basados ​​en fases de mayor sensibilidad. El trabajo experimental muestra el método DPM capaz de monitorear interacciones biomoleculares con reactivos de pequeño peso molecular (∼400 Daltons) en tiempo real con una resolución alcanzada de 2x10-6 RIU.


Detección de resonancia de plasmón superficial: desde biomoléculas purificadas hasta células intactas

La resonancia de plasmón de superficie (SPR) se ha convertido en una técnica sin marca bien reconocida para medir la cinética de unión entre biomoléculas desde la invención del primer inmunosensor basado en SPR en la década de 1980. El formato más popular y tradicional para el análisis SPR es monitorear las señales ópticas en tiempo real cuando una solución que contiene moléculas de ligando fluye sobre un sustrato sensor funcionalizado con moléculas receptoras purificadas. En los últimos años, el rápido desarrollo de varios tipos de técnicas de imágenes SPR ha permitido mapear la distribución dinámica de la densidad de masa local dentro de células vivas individuales con altas resoluciones espaciales y temporales y una sensibilidad confiable. Tal capacidad permitió inmediatamente a uno investigar la interacción entre biomoléculas importantes y células intactas de una manera sin etiquetas, cuantitativa y unicelular, lo que llevó a una nueva y emocionante tendencia de bioanálisis de SPR basado en células. En este artículo de tendencia, primero describimos el principio y las características técnicas de dos tipos de técnicas de imágenes SPR basadas en prisma y objetivo, respectivamente. Luego examinamos las aplicaciones basadas en células intactas tanto en biología celular fundamental como en descubrimiento de fármacos. Concluimos el artículo con comentarios y perspectivas sobre los desarrollos futuros.

Los desarrollos recientes en las técnicas de imágenes de resonancia de plasmón de superficie (SPR) permiten mapear sin etiquetas la distribución de masa dentro de las células vivas individuales, lo que lleva a grandes expansiones en los estudios de interacciones biomoleculares desde sustratos homogéneos funcionalizados con biomoléculas purificadas a sustratos heterogéneos que contienen células vivas individuales.


Sensor de imágenes por resonancia de plasma de superficie (SPRI) para la determinación de cistatina basado en papaína inmovilizada

Se ha desarrollado un sensor de resonancia de plasma de superficie (SPRI) para la determinación específica de cistatina. El sensor contiene papaína inmovilizada, que se une a la cistatina de la solución. Se inmovilizó papaína activada con N-hidroxisuccinimida (NHS) y N-etil-N- (3-dimetilaminopropil) carbodiimida (EDC) sobre una superficie de oro modificada con amina. Se utilizó cisteamina para modificar la superficie del oro. Se optimizaron la concentración de papaína y el pH de interacción. Se seleccionó como óptima una concentración de papaína de 1,5 μg mL-1 y un pH de 6,5. La especificidad de la interacción se verificó por la falta de interacción con la albúmina humana. El rango de respuesta dinámica de los sensores está entre 0 y 0,6 μg mL-1, y el límite de detección es de 0,09 μg mL-1. Los resultados se validaron mediante comparación con el método PETIA (ensayo inmunoturbidimétrico mejorado con partículas) que mostró una buena concordancia. Se utilizó una curva de calibración de cistatina de clara de huevo de gallina o cistatina C. Para demostrar el potencial de los sensores, se determinó la cistatina C en plasma sanguíneo, orina y saliva, mostrando una buena concordancia con los datos reportados en la literatura. Se encontró que los resultados de la concentración de cistatina en el plasma sanguíneo de personas que padecían leucemia estaban por debajo del nivel normal de cistatina.

Letras de proteínas y péptidos

Título: Sensor de imágenes de resonancia de plasma de superficie (SPRI) para la determinación de cistatina basado en papaína inmovilizada

VOLUMEN: 18 ASUNTO: 1

Autor (es):E. Gorodkiewicz y J. Luszczyn

Afiliación:Departamento de Electroquímica, Instituto de Química, Universidad de Bialystok, Al.J. Pilsudskiego11 / 4, 15-443 Bialystok, Polonia.

Abstracto: Se ha desarrollado un sensor de imágenes por resonancia de plasma de superficie (SPRI) para la determinación específica de cistatina. El sensor contiene papaína inmovilizada, que se une a la cistatina de la solución. Se inmovilizó papaína activada con N-hidroxisuccinimida (NHS) y N-etil-N- (3-dimetilaminopropil) carbodiimida (EDC) sobre una superficie de oro modificada con amina. Se utilizó cisteamina para modificar la superficie del oro. Se optimizaron la concentración de papaína y el pH de interacción. Se seleccionó como óptima una concentración de papaína de 1,5 μg mL-1 y un pH de 6,5. La especificidad de la interacción se verificó por la falta de interacción con la albúmina humana. El rango de respuesta dinámica de los sensores está entre 0 y 0,6 μg mL-1, y el límite de detección es 0,09 μg mL-1. Los resultados se validaron mediante comparación con el método PETIA (ensayo inmunoturbidimétrico mejorado con partículas) que mostró una buena concordancia. Se utilizó una curva de calibración de cistatina de clara de huevo de gallina o cistatina C. Para demostrar el potencial de los sensores, se determinó la cistatina C en plasma sanguíneo, orina y saliva, mostrando una buena concordancia con los datos reportados en la literatura. Se encontró que los resultados de la concentración de cistatina en el plasma sanguíneo de personas que padecían leucemia estaban por debajo del nivel normal de cistatina.


Resultados y discusiones

Imágenes SPRM del virus de la influenza A y nanopartículas de sílice.

Figura 2A muestra imágenes SPRM de nanopartículas de sílice de diferentes tamaños y del virus de la influenza A H1N1. Debido a que la imagen SPR es sensible a la superficie, solo las partículas que están sobre o muy cerca de la superficie son visibles. Las partículas virales de la influenza A tienen un rango de tamaño de 90 a 110 nm, según la literatura (4). Las nanopartículas de sílice también son más pequeñas que el límite de difracción del microscopio y no son visibles en la imagen de transmisión. Las imágenes SPR de nanopartículas virales y de sílice se muestran como puntos brillantes con un interesante patrón de difracción en forma de V. Este patrón se debe a la dispersión de las ondas de plasmón superficial por las nanopartículas, que se discutirá en detalle más adelante.

(A) Imágenes SPRM del virus de la influenza A H1N1 y tres nanopartículas de sílice de diferentes tamaños en tampón PBS. (Recuadros) Imágenes de nanopartículas generadas por simulación numérica. (B y C) Los perfiles de intensidad de SPR de partículas seleccionadas a lo largo de las direcciones X e Y (indicadas por líneas discontinuas en A, respectivamente. (Recuadros) Perfiles correspondientes de imágenes simuladas.

Resolucion espacial.

Figura 2 B y C muestra los perfiles de intensidad de la imagen de nanopartículas virales y de sílice seleccionadas, a lo largo de (Y) y perpendicular a (X) la dirección de propagación del plasmón superficial, respectivamente (marcada con líneas discontinuas en la Fig.2A). Independientemente del tamaño de las partículas, los perfiles de dirección perpendicular muestran un ancho completo a la mitad del máximo (FWHM) de aproximadamente 0,5 μm, lo que se debe al límite de difracción óptica. El límite de difracción teórico del microscopio con láser de 632 nm y objetivo NA 1.65 es de 0.23 μm, y la diferencia entre los dos números se debe a que el rayo láser incidente no cubre completamente la apertura completa del objetivo en nuestra configuración, lo que resulta en una menor apertura numérica efectiva (Fig. 1). El perfil de intensidad a lo largo de la dirección de propagación del plasmón superficial revela que la intensidad decae con una longitud de decaimiento de aproximadamente 3 μm. La disminución de la intensidad mide la longitud de propagación finita de las ondas de plasmón de superficie (Fig.2C), que depende del tipo de metal y la longitud de onda de la luz incidente. Por ejemplo, si se usa luz de 532 nm, la longitud de propagación se reduce a aproximadamente 0,2 μm para el oro en agua, cerca del límite de difracción (16). A menudo se observan oscilaciones en la intensidad causadas por los patrones de interferencia del sistema óptico, pero no se mueven con la traslación xoy del microscopio y pueden separarse fácilmente de las características reales de la muestra.

Esquema de la configuración del experimento SPRM (dibujo no a escala). Puede encontrar una descripción detallada de la configuración en Materiales y métodos.

Patrón de difracción.

Los patrones de difracción asociados con las partículas individuales nos ayudan a identificar las nanopartículas a partir de los ruidos de fondo y los patrones de interferencia. Imágenes SPRM simuladas numéricamente de nanopartículas (Fig.2A Recuadros) confirman que los patrones se deben a la dispersión de ondas de plasmón superficial inducida por nanopartículas. Los perfiles de línea calculados (Fig.2 B y C Recuadros) coinciden bien con los perfiles medidos. Además, la intensidad máxima calculada del patrón de difracción aumenta con el tamaño de partícula, lo que también está de acuerdo con los datos experimentales.

Interacciones virus-superficie.

Al rastrear las imágenes de partículas a lo largo del tiempo, podemos diferenciar diferentes tipos de interacciones virus-superficie. Obtuvimos imágenes SPRM del virus de la influenza en tres superficies diferentes: oro desnudo, superficie funcionalizada con PEG y superficie funcionalizada antiinfluenza. Fig. 3A muestra una secuencia de tiempo de imágenes SPRM de partículas de influenza A en oro. Hay disponible un video (Película S1) de esta secuencia. La adhesión de las partículas virales a la superficie del oro se observa inmediatamente después de añadir la solución viral a la solución tampón. Por el contrario, las nanopartículas de sílice no se adhieren a la superficie y aparecen y desaparecen de la imagen debido al movimiento browniano (ver Película S2).

Imágenes SPRM del virus de la influenza A en oro desnudo. (A) Secuencia de imágenes SPRM del virus de la influenza. El mapa de color muestra la intensidad relativa de la imagen SPR en mDeg. (B) La intensidad de la SPR cambia con el tiempo en las regiones (indicadas por rectángulos) donde las partículas virales individuales se adsorben en la superficie de oro.

Fig. 3B muestra las intensidades promediadas de tres partículas virales representativas (mostradas como rectángulos de línea discontinua en la Fig.3A) a lo largo del tiempo sobre una superficie de oro desnudo. Los momentos en los que aparecen las partículas virales en la imagen SPRM se indican con flechas. Una vez que una partícula viral golpea la superficie, permanece en la superficie, lo que indica una adsorción inespecífica fuerte e irreversible de las partículas virales en el oro.

Por el contrario, el virus se comporta de manera bastante diferente en las superficies recubiertas con PEG y con anticuerpos. Figura 4A muestra perfiles típicos de intensidad de SPRM a lo largo del tiempo para partículas virales de influenza A individuales en las dos superficies. On the PEG-functionalized surface, the individual viral particles are imaged only as transient events—they appear and disappear rapidly, which is completely different from the behavior on the bare gold surface. This observation is expected because PEG coating is well known for its capability to block nonspecific binding of biomolecules to surfaces. The transient appearance and disappearance of the viral particles on the PEG-coated surface is due to Brownian motion. On the antibody-functionalized surface, the behavior of the viral particles is in between the two limits described above. We observed that individual viral particles tended to stay on the surface for much longer time than on the PEG-coated surface, but they eventually leave the surface. This observation can be attributed to a reversible binding of the viral particles to the antibody-coated surface.

(A) SPR intensity vs. time profiles for influenza A viral particles on PEG and antiinfluenza A antibody-functionalized surfaces. (B) Histogram showing relative binding probabilities of influenza A on PEG and antiinfluenza A antibody-functionalized surfaces. The analysis of control experiment, HCMV on antiinfluenza A antibody-functionalized surfaces, is also shown for comparison. Note the vertical axis of the histogram is the probability of a particle stays on the surface (determined from the time profiles similar to A).

By tracking the individual viral particles in the SPRM image over time, we obtain the probabilities of individual influenza particles staying on the PEG and antiinfluenza-coated surfaces (Fig. 4B). For comparison, the statistical analysis of human cytomegalovirus (HCMV) on the antiinfluenza antibody-coated surface is also plotted in Fig. 4B. The histogram clearly shows that the specific binding of influenza A on the antibody-coated surface is significantly higher than the nonspecific bindings in the two control experiments, influenza A on the control PEG surface and the control virus, HCMV, on the antibody surface.

The single virus detection with our SPRM was carried out in a static solution, but the findings are consistent with those obtained with the conventional flow-through SPR measurement using samples with the same concentrations (Fig. S1). For example, the injection of 0.1 ml of 0.05 mg/ml influenza A solutions at a flow rate of 30 μl/ min resulted in a large irreversible binding of the virus on the bare gold chip, which is due to strong nonspecific interactions between influenza A and gold surface. On a PEG-functionalized chip, no virus binding was detected by the flow-through SPR. On an antibody-coated chip, approximately 45 mDeg SPR angular shift was observed, which is in between the two extremes. Finally, the flow-through SPR detected no significant binding of HCMV (0.25 mg/ml) onto the antiinfluenza A-coated chip.

Quantitative Analysis of Influenza A Size and Mass.

Mass is a fundamental physical parameter of substances, and precise measurement of mass is one of the most important analytical methods, such as mass spectroscopy (17). A widely used method to measure virus mass is based on ultracentrifugation, which determines the averaged mass of virus in a sample from density gradient sedimentation (18, 19). SPR measures the optical mass of each viral particle, which is directly related to the inertia mass of the particle. To determine the mass of influenza virus, we used silica nanoparticles with a refractive index of 1.46 as calibration standard. The refractive index of influenza based on its protein and lipid contents is approximately 1.48, close to that of the silica nanoparticles. Dry influenza consists of 70 to 75% proteins and 20 to 24% lipids (20), and the mass density of hydrated influenza virus is 1.19 g/ml (20, 21). At such a mass density, the refractive index of a protein solution is 1.48 (22), and the refractive index of lipids is similar (23). Based on these considerations, the refractive index of influenza virus was taken to be 1.48.

We measured the intensities of the individual nanoparticles from the SPRM images and constructed histograms for silica nanoparticles and influenza viral particles (Fig. 5A). The histograms of the silica nanoparticles can be approximately fit with Gaussian distributions, but a small peak appears at an intensity twice of the main peak in each histogram (arrows in Fig. 5A). We attributed it to the formation of nanoparticle dimers. Figura 5B plots the relative SPRM intensity at the peak of each histogram vs. silica nanoparticle volume determined from the size and density provided by the manufacturers for each particle sample (Table S1). The intensity of a nanoparticle is expected to be proportional to the volume of the particle exposed in the evanescent field associated with the propagating surface plamsons. By considering that the evanescent field decays exponentially with distance from the surface, we express the intensity with [1] where k is a constant (fitting parameter), z is distance above the gold surface, r is radius of the particle, and l is the decay constant of the evanescent field, which is approximately 200 nm. Eq. 1 provides a good fit to the experimental data shown in Fig. 5B (solid line).

(A) Histograms of relative SPR intensity distributions of individual silica nanoparticles and influenza A viral particles. The solid red lines are Gaussian fittings of the distributions. Arrows indicate peaks that are likely due to the formation of dimmers. (B) Calibration curve of SPR intensity plotted vs. particle volumes. The average volume of an influenza particle is obtained from the calibration curve and the average SPR intensity in the histogram plotted in A. The vertical error bars are standard deviations of the Gaussian fittings of the histograms of the SPR intensities. The horizontal error bars for the silica nanoparticles are standard deviations calculated from the coefficient of variation of particle diameter given by the manufacturers, and the horizontal error bars for the influenza are estimated from the standard deviation of the volume extracted from the SPR intensity.

From the calibration curve shown in Fig. 5B and the histogram in Fig. 5A, the volume and diameter of influenza A were found to be 6.8 ± 3.0 × 10 -4 μm 3 and 109 ± 13 nm, respectively. Given that the mass density of influenza A is 1.19 g/ml (19), the mass of influenza A virus was determined to be 0.80 ± 0.35 fg, which is in good agreement with the literature values (4, 20, 21) (see Apéndice SI for details).

Using the same method, we also obtained the histogram of SPRM image intensity for HCMV viral particles (Fig. S2). Using the calibration curve in Fig. 5B, we find that the average volume and diameter of a HCMV viron are 5.4 ± 0.7 × 10 -3 μm 3 and 218 ± 10 nm (assuming the refractive index of HCMV is 1.48), respectively, which are in consistent with the literature (approximately 230 nm diameter) (24). Using a reported density of 1.219 g/ml (25), we calculated that the mass of each HCMV viron is 6.5 ± 0.8 fg.

Detection Limit.

Fig. S3 shows the noise level of current setup. The noise level for an area covering a single particle image (∼3 × 5 μm) is 0.3 mDeg. Most SPR detections have time resolution of about one second. Using a one-second moving average, we can reduce the noise to 0.04 mDeg. This noise level, according to the calibration curve in Fig. 5, can detect 13 nm nanoparticles, corresponding to a detectable mass of approximately 1 × 10 -18 g (1 ag).

A more useful way to define the detection limit is detectable mass per unit sensing area, because it is directly related to the detectable analyte concentration in solution, an important quantity for most applications. This detection limit definition also allows one to compare sensors with different sensing areas. For instance, a small sensor may have a lower total mass detection limit, but its small sensing area makes it less likely to detect the analyte molecules. For our current SPRM setup, the entire image area is the sensing area, which is 0.08 × 0.06 mm 2 , so the binding of a single particle with mass as small as 1 ag on the sensing area can be detected. In terms of mass per unit area, the achieved detection limit is 0.2 fg/mm 2 , which is nearly four orders of magnitude better than the typical detection limit of the conventional SPR (15). This improved detection limit is provided by our capability of imaging single viral particles, which allows us to average signals in the regions of viral particles only so that noises in all other regions do not affect the signals of the particles. We note that further improvement in the detection limit may be achieved by using less noisy light source and CCD and by reducing mechanical vibrations of the system.


Biophysics uses biophysical instrumentation to characterize macromolecules in solution and study molecular interactions. The platform uses mass spectrometry for protein identification and small molecule identification and quantification and performs quality control of recombinant proteins for optimized data quality in downstream applications.

The platform ensures proper instrument function with routine maintenance and checks for high standards of performance.

As an active member of the ARBRE-MOBIEU EU network, a cluster of biophysics facilities across Europe, the platform contributes to improving information exchange, development and evaluation of new technologies.

  • State of the art instrumentation UV-VIS spectrophotometer: Protein/nucleic acid quantification. Enzyme kinetics.
  • Circular Dichroism (CD): Information about secondary structure and protein stability.
  • Fluorescence Spectroscopy (FS): Binding studies.
  • Differential Scanning Fluorimetry (DSF): Thermal stability of globular proteins. Protein quality controls (optimal buffers for downstream applications, storage conditions).
  • Dynamic Light Scattering (DLS): Sizes and distributions of biomolecules in solution.
  • Size Exclusion Chromatography coupled to Multi-Angle Light Scattering (SEC-MALS): Absolute molar mass determination.
  • MicroScale Thermophoresis (MST): Measurement of binding interactions.
  • Isothermal Titration Calorimetry (ITC): Thermodynamic technique to study different binding events.
  • Surface Plasmon Resonance (SPR): Measurement of biomolecular interactions in real time.Provides kinetic information (ksobre y kapagado rates). Screening of low molecular weight analytes.
  • Mass spectrometer (ESI-TOF MS).: Protein identification. Small molecule identification and quantification.


Ver el vídeo: PRUEBA E INSTALACION ANALIZADOR CUANTICO QMAQ6 LECTOR PALMA DE MANO (Agosto 2022).