Información

6.2.1: Expresión genética en la evolución - Biología

6.2.1: Expresión genética en la evolución - Biología



We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Objetivos de aprendizaje

  • Con ejemplos, describa cómo los cambios en la expresión génica pueden asociarse con cambios en el fenotipo y la evolución.

Las mutaciones pueden ocurrir en ambos cis-elementos y trans-factores; ambos pueden resultar en patrones alterados de expresión génica. Si un patrón alterado de expresión génica da como resultado una ventaja selectiva (o al menos no produce una desventaja importante), pueden seleccionarse y mantenerse en poblaciones futuras. Incluso pueden contribuir a la evolución de nuevas especies. Un ejemplo de un cambio de secuencia en un potenciador se encuentra en la Pitx gene.

Ejemplo: Pitx expresión en Stickleback

El de tres espinas espinoso proporciona un ejemplo de selección natural de una mutación en un cis-Elemento regulador. Este pez se presenta en dos formas: (1) poblaciones que habitan en aguas profundas y abiertas y tienen una aleta pélvica espinosa que disuade a los peces depredadores más grandes de alimentarse de ellos; (2) poblaciones de ambientes de aguas poco profundas y carecen de esta aleta pélvica espinosa. En aguas poco profundas, parece que una aleta pélvica larga y espinosa sería una desventaja porque con frecuencia entra en contacto con el sedimento en el fondo del estanque y permite que los insectos parásitos en el sedimento invadan el espinoso. Los investigadores compararon las secuencias de genes de individuos de ambientes de aguas profundas y someras. Observaron que en los embriones de la población de aguas profundas, un gen llamado Pitx se expresó en varios grupos de células, incluidas las que se desarrollaron en la aleta pélvica. Embriones de la población de aguas someras expresados Pitx en los mismos grupos de células que la otra población, con una importante excepción: Pitx no se expresó en la aleta pélvica primordio en la población de aguas poco profundas. Un análisis genético posterior mostró que la ausencia de Pitx La expresión génica de la aleta pélvica en desarrollo del espinoso de aguas poco profundas se debió a la ausencia (mutación) de un elemento potenciador particular aguas arriba de Pitx.

Figura ( PageIndex {1} ): El desarrollo de una aleta pélvica grande y espinosa en el espinoso de aguas profundas (izquierda) depende de la presencia de un elemento potenciador particular aguas arriba de un gen llamado Pitx. Los mutantes que carecen de este elemento y, por lo tanto, de la gran aleta pélvica (derecha), se han seleccionado para entornos de aguas poco profundas. (Wikipedia-Richard Wheeler-GFDL)

Pensando en la mutación

Considere el elemento potenciador mutado en los espinosos de aguas poco profundas:

¿Cuál es la función de esa secuencia de ADN? ¿Qué tipo de proteína se uniría allí?

¿Crees que esta mutación actúa de forma dominante o recesiva?

¿Cuáles de estos procesos se ven afectados por la mutación: replicación, transcripción, empalme y / o traducción del ADN?

¿Sería posible que otra mutación invirtiera los efectos de esta mutación y un espinoso de aguas poco profundas con una aleta larga?

Ejemplo: expresión de hemoglobina en mamíferos placentarios.

Hemoglobina es el componente transportador de oxígeno de los glóbulos rojos (eritrocitos). La hemoglobina suele existir como tetrámeros de cuatro moléculas de hemoglobina unidas de forma no covalente. Cada molécula de hemoglobina consta de una globina polipéptido con una molécula de hemo unida covalentemente. El hemo se produce a través de una vía metabólica especializada y luego se une al polipéptido de globina a través de modificación post-traduccional.

La composición de los tetrámeros cambia durante el desarrollo. Desde la primera infancia en adelante, la mayoría de los tetrámeros son del tipo ( mathbf { alpha} )2 ( mathbf { beta} )2, lo que significa que contienen dos copias de cada una de dos proteínas de globina ligeramente diferentes llamadas ( alpha ) y ( beta ). Una pequeña cantidad de hemoglobina adulta es ( alpha )2(delta)2, que tiene ( delta ) globina en lugar de la globina ( beta ) más común. Otras combinaciones tetraméricas predominan antes del nacimiento: ( zeta )2 ( varepsilon )2 es más abundante en embriones, y ( alpha )2(gama)2 es más abundante en fetos. Aunque las seis proteínas de globina ( ( alpha ) = alfa, ( beta ) = beta, ( gamma ) = gamma, ( delta ) = delta, ( varepsilon ) = epsilon , ( zeta ) = zeta) son muy similares entre sí, tienen propiedades funcionales ligeramente diferentes. Por ejemplo, la hemoglobina fetal tiene una mayor afinidad por el oxígeno que la hemoglobina adulta, lo que permite que el feto extraiga oxígeno de la sangre materna de forma más eficaz. Los genes de globina ( gamma ) especializados que son característicos de la hemoglobina fetal se encuentran sólo en mamíferos placentarios.

Figura ( PageIndex {3} ): Expresión de genes de globina durante el desarrollo prenatal y posnatal en humanos. También se indican los órganos en los que los genes de globina se expresan principalmente en cada etapa del desarrollo. (Origianl-Deyholos-CC: AN)

Cada uno de estos polipéptidos de globina está codificado por un gen diferente. En los seres humanos, los genes de globina se encuentran en grupos en dos cromosomas (Figura ( PageIndex {4} )). Podemos inferir que estos grupos surgieron a través de una serie de duplicaciones de un gen de globina ancestral. Duplicación de genes Los eventos pueden ocurrir a través de errores raros en procesos como la replicación del ADN, la meiosis o la transposición. Los genes duplicados pueden acumular mutaciones independientemente unos de otros. Las mutaciones pueden ocurrir en las regiones reguladoras (por ejemplo, regiones promotoras), en las regiones codificantes o en ambas. De esta forma, los promotores de genes de globina han evolucionado para expresarse en diferentes fases de desarrollo y producir proteínas optimizadas para el entorno prenatal.

Figura ( PageIndex {4} ): Fragmentos del cromosoma humano 11 y el cromosoma humano 16 en los que se encuentran agrupaciones de genes goblin ( beta ) y ( alpha ) similares, respectivamente. Algunos investigadores también han descrito genes de globina adicionales ( ( theta ), ( mu )), pero no se muestran aquí. (Origianl-Deyholos-CC: AN)

Por supuesto, no todas las mutaciones son beneficiosas: algunas mutaciones pueden conducir a la inactivación de uno o más de los productos de la duplicación de un gen. Esto puede producir lo que se llama pseudogén. También se encuentran ejemplos de pseudogenes ( ( psi )) en los cúmulos de globina. Los pseudogenes tienen mutaciones que les impiden expresarse en absoluto. Los genes de globina proporcionan un ejemplo de cómo la duplicación y mutación de genes, seguidas de la selección, permiten que los genes desarrollen patrones y funciones de expresión especializados. Muchos genes han evolucionado como familias de genes de esta manera, aunque no siempre se agrupan como las globinas.

Ejercicio ( PageIndex {1} )

Los individuos con enfermedades como la anemia de células falciformes o ( beta ) - talasemia tienen mutaciones que causan una proteína malformada o la ausencia de la proteína HBB (beta-globina). ¿Cómo podría la comprensión de la expresión normal de otras proteínas de hemoglobina ayudar a desarrollar nuevas terapias para estos pacientes? ¿Qué herramientas y procesos se pueden utilizar?

Respuesta

Los ensayos clínicos recientes están explorando la posibilidad de utilizar la edición de genes para expresar la hemoglobina fetal en pacientes con anemia drepanocítica y beta-talesemia. Este proceso aísla las células madre de los pacientes, edita el ADN in vitro, y luego trasplanta las células editadas nuevamente al paciente (revisado en https://academic.oup.com/hmg/advance-article/doi/10.1093/hmg/ddaa088/5836961).

Un informe de noticias sobre uno de estos pacientes se encuentra en este enlace https://www.npr.org/sections/health-shots/2020/06/23/877543610/a-year-in-1st-patient-to-get- la edición de genes para la enfermedad de células falciformes está prosperando.

Referencias seleccionadas:

Ye L, Wang J, Tan Y, et al. (2016) Edición del genoma utilizando CRISPR-Cas9 para crear el genotipo HPFH en HSPC: un enfoque para tratar la anemia de células falciformes y la β-talasemia. Proc Natl Acad Sci U S A. 2016; 113 (38): 10661-10665. doi: 10.1073 / pnas.1612075113 (https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5035856/)

Weber L, Frait G, Felix T, et al. (2020) La edición de un sitio de unión del represor de γ-globina restaura la síntesis de hemoglobina fetal y corrige el fenotipo de la enfermedad de células falciformes. Avances de la ciencia 12 de febrero de 2020 (https://advances.sciencemag.org/content/6/7/eaay9392?utm_source=TrendMD&utm_medium=cpc&utm_campaign=TrendMD_1)

Demirci S, Leonard A, Tisdale JF. (2020) Estrategias de edición del genoma para la inducción de hemoglobina fetal en beta-hemoglobinopatías. Genética molecular humana 14 de mayo de 2020. https://doi.org/10.1093/hmg/ddaa088


La evolución y la importancia funcional de las estructuras genéticas anidadas en Drosophila melanogaster

Casi el 10% de los genes del genoma de Drosophila melanogaster están en estructuras anidadas, en las que un gen está completamente anidado dentro del intrón de otro gen (anidado e incluido el gen, respectivamente). Aunque las secuencias codificantes y las regiones no traducidas de estos pares de genes anidados / incluidos no se superponen, sus estructuras íntimas y la posibilidad de secuencias reguladoras compartidas plantean preguntas sobre las fuerzas evolutivas que gobiernan el origen y los impactos funcionales y evolutivos posteriores de estas estructuras. En este estudio, mostramos que los genes anidados experimentan una restricción evolutiva más débil, tienen tasas más rápidas de evolución de proteínas y se expresan en menos tejidos que otros genes, mientras que los genes incluidos muestran patrones opuestos. Sorprendentemente, a pesar de que se superponen completamente entre sí, es menos probable que los genes anidados e incluidos muestren una expresión génica correlacionada y una función biológica que los genes cercanos pero que no se superponen. Curiosamente, se transcriben significativamente menos genes anidados a partir de la misma hebra que el gen incluido. Descubrimos que es más probable que los genes anidados en la misma hebra sean genes de un solo exón. Además, es menos probable que los genes que incluyen la misma hebra tengan fenotipos letales o estériles conocidos que los genes que incluyen hebra opuesta sólo cuando los genes anidados correspondientes tienen intrones. Estos resultados apoyan nuestra hipótesis de que la selección contra posibles empalmes de ARNm erróneos cuando los genes anidados e incluidos están en la misma hebra desempeña un papel importante en la evolución de las estructuras génicas anidadas.

La distribución de genes en el genoma no es aleatoria. Hay regiones con pocos genes funcionales y regiones donde los genes están densamente empaquetados. Se sabe que la gran proximidad entre genes puede tener importantes consecuencias funcionales. De hecho, se demostró que los genes vecinos tenían patrones de expresión correlacionados en eucariotas (incluida la levadura [Cohen et al. 2000], Caenorhabditis elegans [Lercher y col. 2003], Drosophila [Boutanaev y col. 2002], Arabidopsis thaliana [Williams y Bowles 2004], y humanos [Lercher et al. 2002 Trinklein y col. 2004]), así como funciones biológicas y / o vías de señalización (Elo et al. 2003 Lee y Sonnhammer 2003 Al-Shahrour et al. 2010). En casos extremos, la distancia entre genes vecinos es 0 y partes o todas sus estructuras genéticas (exones, intrones o regiones no traducidas [UTR]) se superponen entre sí (genes superpuestos). Estas estructuras se observan comúnmente en eucariotas (p. Ej., C. elegans [Chen y Stein 2006], Drosophila [Misra et al. 2002] y mamíferos [Veeramachaneni et al. 2004]).

Una clase especialmente interesante de genes superpuestos es aquella en la que un gen está completamente anidado dentro de un intrón de otro gen (anidado e incluido el gen, respectivamente [revisado en Kumar 2009]). Aunque las secuencias de codificación de estos pares de genes anidados / incluidos no se superponen, sus estructuras íntimas plantean preguntas sobre las fuerzas evolutivas que gobiernan el origen de las estructuras de genes anidados y sus posteriores impactos funcionales y evolutivos. Encontramos que, en Drosophila melanogaster, aproximadamente el 16% de los genes (2.295 de 14.072 genes) se superponen con al menos otro gen en exones, intrones o UTR. Los genes en estructuras anidadas representan el 9,5% de la D. melanogaster genes (1338 genes), que es más de C. elegans (2,7%, Chen y Stein 2006) y humanos (2,73%, Yu et al. 2005). Examinar el significado evolutivo y funcional de las estructuras genéticas anidadas en D. melanogaster mientras controlamos los atributos intrínsecos de los genes en las proximidades, comparamos pares de genes anidados / incluidos con & # x0201c pares de genes de control, & # x0201d que tienen distribuciones cromosómicas coincidentes con las de los pares de genes anidados / incluidos y están a 500 pb entre sí, pero no se superpongan (consulte Materiales y métodos).

La entrada mutacional es un determinante clave de la ubicación de los genes anidados

El análisis anterior mostró que la mayoría de las estructuras genéticas anidadas en Drosophila se originó a través de inserciones o el origen de novo de secuencias codificantes en intrones (Assis et al. 2008). Los intrones más grandes son objetivos más grandes para la inserción o mutaciones de novo y deberían ser más propensos a albergar genes anidados. De hecho, encontramos que las longitudes totales de intrones de los genes incluidos son significativamente más largas que las de los genes de control, incluso después de excluir la secuencia a la que contribuyen los genes anidados (mediana: 12,183 [incluido] y 308 [control] Mann & # x02013Whitney U prueba (MWU) PAG & # x0003c 10 & # x0221216). Los genes incluidos también tienen más intrones que los genes anidados y los genes de control (mediana: 7 [incluido], 2 [control] y 1 [anidado] MWU, PAG & # x0003c 10 & # x02212 16 para ambas comparaciones). Centrándose en la inclusión de genes, los intrones con genes anidados son significativamente más largos que los intrones sin genes anidados (mediana: 4.826 [con genes anidados] y 138 [sin genes anidados] MWU, PAG & # x0003c 10 & # x02212 16). Debido a que se encontró que los intrones largos se conservaron más evolutivamente y se sugirió que albergan secuencias funcionales más probablemente (Haddrill et al. 2005), esta observación es poco probable debido a que los intrones más grandes son más tolerantes a las inserciones. Además, el D. melanogaster& # x02013D. simulanos La divergencia de los intrones más largos de genes incluidos es menor que la de otros intrones de genes incluidos incluso después de excluir genes anidados (mediana: 0,071 [más largo] y 0,082 [otros] prueba de MWU, PAG = 0,0012), lo que indica que la observación de que los intrones largos se conservan más evolutivamente no es el resultado de una fracción de genes anidados en ellos. Estos resultados apoyan que el proceso mutacional es un determinante clave de la ubicación de los genes anidados.

La selección juega un papel importante en el mantenimiento y la importancia funcional de las estructuras genéticas anidadas

Varias hipótesis que potencialmente explican las presiones selectivas que influyen en la fijación de estructuras anidadas en la población, y su posterior evolución funcional, hacen predicciones específicas sobre las correlaciones expresivas y funcionales actuales de genes anidados e incluidos. Además del entorno cromosómico común que podría haber llevado a la expresión correlacionada de genes en proximidad (revisado en Hurst et al.2004 Oliver y Misteli 2005), los genes en estructuras anidadas podrían verse favorecidos selectivamente si su expresión y / o funciones biológicas están correguladas , lo que da como resultado una expresión y / o funciones biológicas correlacionadas positivamente aún más fuertes que los genes vecinos. Por otro lado, la proximidad de genes anidados e incluidos puede provocar interferencias durante la transcripción, lo que lleva a la selección contra la expresión correlacionada espacial y temporalmente de genes anidados e incluidos (& # x0201interferencia transcripcional & # x0201d [Shearwin et al. 2005 Liao y Zhang 2008 ]). Aún así, la evolución de las estructuras de genes anidados podría ser un proceso casi neutral (Lynch y Conery 2003 Lynch 2006), y la expresión y las correlaciones funcionales entre genes anidados e incluidos serían similares a las de los genes en proximidades.

Los pares de genes anidados / incluidos están significativamente correlacionados positivamente (estimado utilizando el rango de Spearman & # x003c1) en los niveles de expresión génica en los tejidos (FlyAtlas, Chintapalli et al.2007, MWU, PAG = 0,025). Esto también se observa para los pares de genes de control (MWU, PAG & # x0003c 2 & # x000d7 10 & # x02212 16]. Sin embargo, las correlaciones en la expresión de pares de genes anidados / incluidos son significativamente más débiles (rango de Spearman & # x003c1 mediana 0,019 [pares de genes anidados / incluidos] vs.. 0,174 [pares de genes de control], MWU, P = 8.6 & # x000d7 10 & # x02212 14, fig. 1) y menos probabilidades de ser positivo (52,74% [pares de genes anidados / incluidos] vs.. 69,44% [pares de genes de control] Prueba exacta de Fisher & # x02019s [FET], P = 4 & # x000d7 10 & # x02212 9) que los pares de genes de control. De hecho, las correlaciones en la expresión de pares de genes anidados / incluidos no son diferentes de dos genes elegidos al azar que no son adyacentes sino que están en el mismo cromosoma (& # x0201 pares de genes de control aleatorios & # x0201d rango de Spearman & # x003c1 mediana 0,019 [pares de genes anidados / incluidos] vs.. 0,032 [pares de genes de control aleatorios] MWU, P = 0,76, fig. 1). Además, empleamos regresión logística y encontramos que los pares de genes anidados / incluidos tienen menos probabilidades que los pares de genes de control de tener un gen (gen anidado de pares de genes anidados / incluidos) para expresarse en el subconjunto de tejidos de otro gen (incluido el gen de pares de genes anidados / incluidos PAG = 0.05 odds ratio = 0.78), para tener los mismos tejidos expresados ​​más altos (PAG = 8 & # x000d7 10 & # x02212 11 odds ratio = 0,25), y estar asociado con las mismas categorías de GO (Ontología genética) (PAG = 0.002, 0.001, 0.02 odds ratios = 0.14, 0.17, 0.16 para proceso biológico, función molecular y componente celular, respectivamente). Sin embargo, nuevamente, cuando comparamos pares de genes anidados / incluidos con pares de genes de control aleatorios, ninguna de estas tres diferencias fue significativa. Las correlaciones en los patrones de expresión y la participación en funciones biológicas de pares de genes anidados / incluidos son significativamente diferentes de lo que se ha observado para genes cercanos que no se superponen, lo que sugiere que la selección contra la interferencia transcripcional podría haber llevado a su expresión en diferentes tejidos y participación en diferentes funciones biológicas. .

Distribuciones de Spearman & # x003c1 en la expresión génica para pares de genes anidados / incluidos y pares de genes de control. Los pares de genes anidados / incluidos tienen una correlación menos positiva en su nivel de expresión en 20 tejidos que los pares de genes de control, pero tienen correlaciones similares en la expresión con pares de genes no adyacentes en el mismo cromosoma (& # x0201 pares de genes de control aleatorios & # x0201d).

La escasez de pares de genes anidados / incluidos en la misma cadena podría resultar de la selección contra el empalme incorrecto

Los genes anidados se pueden transcribir a partir de la misma hebra que sus genes incluidos (la misma hebra) o una hebra diferente de sus genes incluidos (hebra opuesta). Se encontró que la mayoría de los genes anidados (71,27%) estaban en la hebra opuesta. Esta proporción es significativamente diferente de la proporción de los pares de genes de control (53,55%) y de la proporción esperada si las orientaciones son aleatorias (50% FET, P & # x0003c 10 & # x02212 16 para ambas comparaciones). Aunque los sesgos de hebra de genes anidados se han informado ampliamente en diferentes eucariotas (63% de genes anidados en la misma hebra en humanos [Yu et al. 2005] y 88% en C. elegans [Chen y Stein 2006]), la causa biológica de este sesgo no se ha discutido ni probado específicamente en una escala genómica.

La escasez de estructuras génicas anidadas en la misma hebra puede deberse a los sesgos intrínsecos de las hebras de los procesos mutacionales que conducen a estructuras génicas anidadas. Alternativamente, esto puede deberse a la selección diferencial en genes anidados en la misma hebra y en la hebra opuesta. Se sabe que varios casos de genes, elementos transponibles o retrovirus endógenos que están anidados dentro de intrones de otros genes causan un empalme aberrante de los genes externos, incluidos (Horowitz y Berg 1995 Kaer et al. 2011 Maksakova et al. 2006). Se demostró que el empalme incorrecto de los genes incluidos depende de la presencia de sitios de empalme dentro de las secuencias de elementos transponibles o virus endógenos (van de Lagemaat et al. 2006 Kaer et al. 2011). Es más probable que los sitios de empalme de los genes anidados interfieran con el empalme de los genes incluidos cuando los dos genes se transcriben a partir de la misma hebra. De acuerdo con esta hipótesis, encontramos que los genes anidados en la misma hebra tienen más probabilidades de ser genes de exón único (72,53%) que los genes anidados en hebras opuestas (37,41% FET, PAG & # x0003c 10 & # x02212 16). Centrándose en genes anidados que tienen más de un exón, los genes anidados en la misma hebra todavía tienen menos intrones que los genes anidados en hebras opuestas (mediana: un intrón (genes anidados en la misma hebra) vs.. dos intrones [genes anidados de hebra opuesta] MWU, PAG = 0,00013). Nuestra observación no se debe a que los genes anidados de hebra opuesta sean más largos que sus homólogos de la misma hebra porque la longitud de la secuencia codificante no es estadísticamente diferente entre genes anidados de la misma hebra y hebra opuesta (mediana: 817,5 [misma hebra] frente a 898 [ hebra opuesta] MWU, PAG = 0.11).

Setenta y tres genes anidados son jóvenes (menos de 35 millones de años [Clark et al. 2007 Zhang et al. 2010]) y se originaron a través de la duplicación de otro gen (gen parental). El proceso de duplicación puede ser a través de intermedios de ADN o ARN. Una característica de la duplicación basada en ARN es que los nuevos genes pierden todos los intrones que estaban presentes originalmente en su gen parental (revisado en Kaessmann et al. 2009), y este proceso representa alrededor del 12,10% de los genes duplicados en Drosophila (Zhang et al. 2010). Entre los 73 genes anidados duplicados, solo el 16,67% de los genes duplicados anidados de hebra opuesta se originaron a través de la duplicación basada en ARN, mientras que el 42,11% de los genes duplicados anidados en la misma hebra se originaron a través de intermedios de ARN (FET, PAG = 0,054). Esta diferencia es marginalmente significativa, probablemente debido al pequeño tamaño de la muestra. Además, la disminución en el número de intrones de genes anidados duplicados, en comparación con sus genes parentales respectivos, es significativamente mayor para genes duplicados anidados en la misma hebra que para genes duplicados anidados en hebras opuestas (mediana: una diferencia de intrón [genes anidados en la misma hebra] vs diferencia de intrón cero [genes anidados de hebra opuesta] MWU, PAG = 0,028). Tenga en cuenta que esta diferencia no se debe a la variación en el número de intrones de los genes parentales de genes anidados en la misma hebra y en la hebra opuesta, que no es significativamente diferente (MWU, PAG = 0.41).

Si es más probable que ocurra un empalme incorrecto cuando se incluyen genes y los genes anidados están en la misma hebra que cuando están en hebras opuestas, esperamos que la misma hebra, incluidos los genes, sea menos probable que sea esencial para la aptitud de las moscas. En casos extremos, esperamos que la pérdida de función o la caída de la expresión por interferencia de ARN (ARNi) de la misma hebra, incluidos los genes, sea menos probable que se asocie con fenotipos letales. Cuando se consideran todos los genes de la misma hebra y hebra opuesta, incluidos los genes, no hay diferencias significativas en la proporción de genes que tienen fenotipos letales conocidos (38,85% [misma hebra] frente a 44,66% [hebra opuesta] tabla 1). Sin embargo, cuando solo consideramos la inclusión de genes cuyos genes anidados tienen intrones (y, por lo tanto, es más probable que causen un empalme incorrecto), la misma hebra, incluidos los genes, es significativamente menos probable que tenga fenotipos letales conocidos (26,0% [misma hebra] frente a 42,33% [ filamento opuesto] tabla 1). El resultado se ve reforzado si consideramos tanto los fenotipos letales como estériles (30,00% [misma hebra] vs 47,44% [hebra opuesta] tabla 1). Vale la pena señalar que la alteración genética (mutante nulo o caída de expresión) que consideramos aquí es extrema, y ​​es probable que, al considerar influencias más sutiles sobre la aptitud, la diferencia entre la misma hebra y la hebra opuesta, incluidos los genes, sea más significativo y debería ser más general. En general, nuestras observaciones de que los genes anidados en la misma hebra contienen menos intrones y que los genes de la misma hebra, incluidos los genes, tienen una menor probabilidad de estar asociados con fenotipos letales y estériles, sugieren que la escasez de pares de genes anidados / incluidos en la misma hebra podría atribuirse a la purificación selección contra el empalme incorrecto cuando los genes anidados se transcriben a partir de la misma hebra.

Tabla 1

Efectos fenotípicos conocidos de la inclusión de genes

LetalEstérilViableFET P Valor
Letal contra no letal a B afectados vs.Viables
Todos incluidos los genesMisma hebra689980.230.2
Hebra opuesta15919178
Incluyendo genes con genes anidados que contienen intronesMisma hebra132350.0370.027
Hebra opuesta9111113

a Genes sin fenotipo letal conocido (podría haber fenotipo estéril conocido).

b Genes con fenotipo letal o estéril conocido.

Los genes anidados evolucionan más rápido, se expresan de manera más estrecha y se enriquecen con funciones relacionadas con los testículos, mientras que los genes incluyen patrones opuestos.

Para probar si los genes en estructuras anidadas muestran diferentes patrones de evolución, examinamos el espectro de frecuencia del sitio de las variantes de codificación (usando Tajima & # x02019s D [Tajima 1989]), tasas relativas de evolución de proteínas (Dnorte/DS, [Yang 2007]) y la proporción de sustituciones de aminoácidos fijadas por selección positiva (& # x003b1, [Smith y Eyre-Walker 2002]) de incluir genes, genes anidados y genes de control, y clasificar los genes en aquellos que están presentes en los 12 Drosophila especies (es decir, genes de más de 35 millones de años de Clark et al. 2007) o no (Zhang et al. 2010) (tabla 2). Incluyendo genes que tienen más Tajima & # x02019s negativos D, más bajo Dnorte/DS, y es más probable que se conserven en todo el Drosophila especies que los genes anidados o los genes de control, lo que sugiere que están bajo una selección purificadora más fuerte. Por otro lado, los genes anidados, aunque no difieren en Tajima & # x02019s D de genes de control, tienen mayor Dnorte/DS y & # x003b1y tienden a ser más jóvenes que ambos, incluidos los genes y los genes de control. No detectamos ninguna diferencia significativa entre la misma hebra y la hebra opuesta, incluidos genes o genes anidados en estos análisis.

Tabla 2

Propiedades evolutivas y patrones de expresión de genes anidados, incluidos y de control

Mediana Prueba MWU PAG Valor
InclusoAnidadoControlIncluido vs.AnidadoIncluyendo vs. ControlAnidado frente a control
Tajima & # x02019s D& # x022122.76& # x022121.77& # x022121.87& # x0003c10 & # x022128 & # x0003c10 & # x022128 & # x0003e0.05
Dnorte/DS0.0420.1070.073& # x0003c10 & # x022128 & # x0003c10 & # x022128 & # x0003c10 & # x022128
& # x003b10.2510.4350.3430.0050.2750.035
Amplitud de expresión (número de tejidos)18419& # x0003c10 & # x0221216 0.363& # x0003c10 & # x0221216
Proporción (%) FET PAG valor
InclusoAnidadoControlIncluido vs.AnidadoIncluyendo vs. ControlControl frente a anidado
Conservado en 12 Drosophila especies99.0588.1391.24& # x0003c10 & # x0221216 & # x0003c10 & # x0221216 0.027
Máxima expresión en el cerebro29.095.219.44& # x0003c10 & # x0221216 & # x0003c10 & # x0221216 0.003
Mayor expresión en testículos6.4343.9113.52& # x0003c10 & # x0221216 1,45 & # x000d7 10 & # x022126 & # x0003c10 & # x0221216
Mayor expresión en ovario13.785.3623.941.3 & # x000d7 10 & # x022127 9.06 & # x000d7 10 & # x022128 & # x0003c10 & # x0221216
Genes duplicados jóvenes0.98.47& # x0003c10 & # x0221212 5.2 & # x000d7 10 & # x0221216 0.02

También encontramos que los genes anidados e incluidos tienen patrones de expresión génica inusuales. Los genes anidados se expresan en significativamente menos tejidos (tienen una amplitud de expresión más estrecha) que los que incluyen genes o genes de control (tabla 2). También tienen una especificidad de expresión significativamente más alta (ver Materiales y métodos) que los genes incluidos o de control (MWU, PAG & # x0003c 10 & # x0221212 para ambas comparaciones fig. 2). Si bien los genes anidados de la misma cadena y de la cadena opuesta no difieren en su amplitud de expresión (MWU, PAG = 0,15), los genes anidados en la misma hebra tienen una especificidad de expresión significativamente mayor que los genes anidados en la hebra opuesta (0,95 [misma hebra] vs.. 0,93 [hebra opuesta] MWU, PAG = 0,009). La composición de los tejidos donde los genes tienen su expresión más alta también es significativamente diferente entre los genes incluidos, los genes anidados y los genes de control (prueba de chi-cuadrado, PAG & # x0003c 10 & # x02212 16 para todas las comparaciones fig. 3). Esta composición no es diferente entre genes de la misma hebra y de la hebra opuesta, incluidos los genes, pero es significativamente diferente entre los genes anidados de la misma hebra y de la hebra opuesta (prueba de chi-cuadrado, PAG = 0,024 fig. 3). Los genes incluidos están más enriquecidos con genes que tienen su expresión más alta en el cerebro que los genes anidados o los genes de control (tabla 2). Por el contrario, los genes anidados están significativamente enriquecidos con genes que tienen la expresión más alta en los testículos, pero son deficientes para los genes que tienen la expresión más alta en los ovarios (tabla 2). El enriquecimiento de la expresión testicular alta es especialmente fuerte para genes anidados en la misma hebra (58,46% [misma hebra] vs.. 38,18% [hebra opuesta] FET, P = 1,67 & # x000d7 10 & # x02212 6).

Especificidad de expresión de genes en estructuras anidadas y genes de control. Diagramas de caja para la especificidad de expresión de la inclusión de genes, genes anidados y genes de control. La especificidad de expresión es más alta para los genes anidados en la misma hebra, seguidos de los genes anidados en la hebra opuesta, los cuales son significativamente más altos que los genes incluidos o los genes de control.

Las distribuciones de tejidos donde los genes tienen su máxima expresión. Los genes anidados, especialmente los genes anidados en la misma hebra, están enriquecidos con genes que tienen su nivel de expresión más alto en los testículos en comparación con los genes incluidos y de control. Por el contrario, los genes incluidos se enriquecen con genes que tienen su máxima expresión en el cerebro.

De acuerdo con el hallazgo anterior de que la mayoría de las estructuras de genes anidados se originaron mediante la inserción de secuencias de ADN en intrones o genes incluidos a través de duplicaciones de genes (Assis et al.2008), observamos una proporción significativamente mayor de genes anidados que se identificaron previamente como genes duplicados jóvenes ( Zhang et al.2010) que incluir genes o genes de control (tabla 2). Los genes duplicados jóvenes tienden a evolucionar rápidamente (Chen et al. 2010), lo que podría haber llevado a las excepcionales propiedades evolutivas observadas de los genes anidados. Por otro lado, las dos propiedades interesantes de los genes anidados, la expresión estrecha (Larracuente et al. 2008) y el enriquecimiento de máxima expresión en los testículos (revisado en Swanson y Vacquier 2002), son ampliamente conocidas por estar correlacionadas con la rápida evolución de las proteínas. Para probar si las inusuales propiedades evolutivas y de expresión de los genes anidados se deben a la mayor proporción de genes duplicados, comparamos los genes anidados con un conjunto de genes de control que tienen la misma proporción de genes jóvenes duplicados (& # x0201c genes de control de duplicación, & # x0201d ver Materiales y métodos). Los genes anidados todavía muestran tasas más rápidas de evolución de proteínas (Dnorte/DS, MWU, P & # x0003c 10 & # x02212 9), tienen mayor & # x003b1 (MWU, P = 0.0021], se expresan en menos tejidos (MWU, P & # x0003c 10 & # x02212 16), tienen mayor especificidad de expresión (MWU, P & # x0003c 10 & # x02212 16) y están enriquecidos con genes que tienen la expresión más alta en los testículos (FET, P & # x0003c 10 & # x02212 16). Estos resultados indican que los patrones observados no podrían explicarse simplemente por la mayor proporción de genes duplicados. Por el contrario, cuando se utiliza otro conjunto de genes de control que tienen los mismos patrones de expresión que los genes anidados (& # x0201 genes de control de expresión, & # x0201d ver Materiales y métodos), los genes anidados no son significativamente diferentes de los genes de control con respecto a Dnorte/DS, & # x003b1, o edad genética (MWU, P & # x0003e 0,05 para todas las comparaciones). En consecuencia, las propiedades evolutivas de los genes anidados podrían haber sido el & # x0201c subproducto & # x0201d de sus atributos de expresión. Sin embargo, la selección para desacoplar las funciones de los genes anidados de las de incluir genes debido a sus estructuras anidadas podría haber llevado a la expresión estrecha observada de genes anidados y podría ser la causa última de las propiedades evolutivas de los genes anidados.

Si bien los genes incluidos evolucionan lentamente, están altamente conservados, se expresan ampliamente y se enriquecen con genes que tienen su expresión más alta en el cerebro, los genes anidados son lo opuesto: evolucionan rápidamente, se expresan estrechamente y se enriquecen con genes que tienen su expresión más alta en los testículos. Por lo tanto, la selección positiva para la corregulación en la expresión génica y la función biológica, que podría haber impulsado la evolución de los grupos de genes (revisado en Hurst et al. 2004), es poco probable que se aplique a la fijación de estructuras génicas anidadas. La fijación de estructuras genéticas anidadas, de manera similar a la evolución de otras organizaciones genómicas complejas (Lynch y Conery 2003 Lynch 2006), podría haber sido un proceso casi neutral. However, we have evidence supporting the role of natural selection in shaping the relative orientations and functional importance of nested gene structures. We showed that nested/including gene pairs are less likely to be transcribed from the same strand and that same-strand nested genes are more likely to be single-exon genes and have fewer exons if they are multiexon genes. Together with the finding that including genes with same-strand nested genes that contain introns are less likely to be essential for fitness of flies, our results support that selection against missplicing events of same-strand nested/including gene pairs leads to this bias. In addition, the correlations in expressions and biological functions of nested/including gene pairs are lower than those of nearby gene pairs but similar to any two random genes of the same chromosome. This is consistent with the hypothesis that selection against transcriptional interference plays an important role in shaping the functional significance and indirectly affects evolutionary properties of nested gene structures. In sum, despite the proximity of nested and including genes, we found that they are nowhere similar to each other in terms of evolutionary properties, expressional patterns, and biological functions, and selection against the potential deleterious impacts caused by their close proximity might have been the main force governing their evolution.


Fondo

Polyunsaturated fatty acids (PUFAs) are essential components of the plasma membrane. Various PUFAs have crucial roles in plant physiological and cellular processes such as cold acclimation, defense mechanisms against biotic and abiotic stresses, and chloroplast development [1]. PUFAs biosynthesis occurs through different and complex pathways of desaturation and elongation steps [2]. Fatty acid desaturase (FAD) enzymes introduce double band into fatty acids hydrocarbon chain. Two groups of FAD have been identified in plants, including acyl–acyl carrier protein (acyl-ACP) desaturases and membrane-bound FADs or acyl-lipid desaturases [3]. While identified FADs in plants, animals, algae, and fungi are membrane-bound desaturase, the plant acyl-ACP desaturase (FAB2/SAD) is the only soluble FAD [4, 5]. The acyl-ACP desaturases introduce the first double band into the acyl chain of saturated fatty acid in plastids. Besides, Membrane-bound FADs exist in chloroplast and endoplasmic reticulum (ER). Desaturation processes occur through two different pathways in the chloroplast and the ER [6]. In the chloroplast and ER, double bond formation requires NADPH/ferredoxin and NADH/cytochrome b5 systems as the electron donors, respectively [7].

On the other hand, the quality of edible oils depends on the unsaturated fatty acids content [8]. FADs are essential to determine the quality of edible oils [9]. They have been attracted more attention due to their ability to adjust the level of unsaturated fatty acids to increase the quality of these oils and plant resistance against various stresses including drought, salt, heat, cold, and pathogen [10,11,12,13]. For instance, the cell membrane is the primary site for cold-induced injury, and the melting temperature of the unsaturated fatty acids is less than saturated fatty acids. Therefore, adjustment of membrane lipid fluidity through manipulation of FADs and changing the levels of unsaturated fatty acids might seem helpful for cold acclimation [14]. To date, several studies have been conducted to assess the expression of genes encoding fatty acid desaturase in response to biotic and abiotic stresses [12, 15,16,17]. Investigation of the expression of SACPD-A y SACPD-B genes (encoding soluble Δ9 stearoyl-ACP desaturases) and the amount of stearic acid (C18:0) and oleic acid (C18:1) in soybean revealed that the number of transcripts of both genes and oleic acid had been dramatically increased in low temperature. Reversely, we observed an increased amount of C18:0 and decreased the expression of the genes above at high temperatures [18]. Wang y col. (2012) ascertained the expression of oleate desaturase (GbFAD2 y GbFAD6) y GbSAD genes under various temperatures in Ginkgo biloba L. leaves. Based on their results, the expression of GbFAD2 y GbSAD genes has been increased in 4 and 15 °C, while it has been prevented in 35 and 45 °C.

In contrast, the expression of GbFAD6 was constant at different temperatures [19]. La expresión de FAD2–1 y FAD2–2 genes of olive has been increased in response to wounding [20]. Igualmente, FAD2 y FAD6 genes are necessary for salt tolerance during early seedling in Arabidopsis [21, 22]. Zhang y col. (2005) developed transgenic tobacco plants with the overexpressing FAD3 o FAD8 genes. According to their findings, the over-expression of FAD8 o FAD3 genes caused enhanced tolerance to drought [23]. The importance of FADs in plant pathways has been confirmed previously. A homologous region based on a conserved sequence of a gene family can be applied to identify new genes. los MODA gene family is vital for the production of PUFAs in plants thus, a comprehensive understanding of MODA genes using bioinformatics studies can help disclose their functions in the studied plants.

Wheat (Triticum aestivum L.) is one of the most important cereal crops. Because of the high amount of unsaturated fatty acids, wheat germ oil, one of the essential by-products of wheat, can be a good alternative for edible oils with clinical benefits. Based on studies, wheat germ oil contain different fatty acids, including linoleic acid (C 18:2), palmitic acid (C 16:0), oleic acid (C 18:1), linolenic acid (C18:3), and stearic acid (C 18:0) [24]. Wheat is a good source of edible oil, and the characterization and analysis of the MODA family in wheat plants have not yet been performed. On the other hand, comprehensive analyses on gene families help to address a better understanding of their evolutions and functions in plants [25]. Therefore, in this study, identification, evolutionary relationship, duplication and selection pressure, exon-intron structure, promoter analysis, transcript-targeted miRNA and simple sequence repeat markers prediction, RNA-seq data analysis, three-dimensional structure, and docking studies of the TaFADs have been investigated in wheat using bioinformatics tools. Figure 1 provides a flow-chart of the data analysis process.

A flow-chart of the data analysis process


Materiales y métodos

Genome Sequences

We retrieved all publicly available prokaryotic genome sequences and associated annotations from the Integrated Microbial Genomes (IMG) system (http://genome.jgi-psf.org/programs/bacteria-archaea/index.jsf) ( Markowitz et al. 2009).

Horizontally Transferred Genes

We used three large data sets of HGTs. The first data set ( Sorek et al. 2007) included genes that can and cannot be transformed into E. coli in laboratory. The second data set ( Lercher and Pal 2008) described genes that were naturally transferred into E. coli at different evolutionary times, inferred from the presence/absence of genes across species. The inference was based on the DELTRAN algorithm, with relative penalties of 2:1 for HGTs and gene losses ( Lercher and Pal 2008), as in a recent study ( Gophna and Ofran 2011). We identified the likely donor species of each horizontally transferred gene in this data set by Blasting the gene with an mi value cutoff of 10 −6 in all 1,127 finished Bacteria and Archaea genomes in IMG that are outside the family Enterobacterias, to which E. coli belongs ( fig. 2A). The genome harboring the best basic local alignment search tool (Blast) hit is considered the donor of the transferred gene. Reciprocal Blast searches are unnecessary, because the best Blast hit of the identified donor gene in E. coli will be 1) either the original gene under investigation or 2) a paralog of the original gene under investigation. But, because the gene under investigation was identified by phylogenetic analysis to be horizontally transferred to E. coli rather than a recent paralog of another gene in E. coli, (2) is not possible. Thus, the only possibility is (1), which makes it unnecessary to Blast the E. coli genome using the identified donor gene as the query. Furthermore, errors in donor identification are expected to be random, which would weaken the true signal but not bias our result. The third data set included relatively recent HGTs identified from 171 recipient genomes by nucleotide composition-based Bayesian inference ( Nakamura et al. 2004). We discarded 38 of these genomes because of the lack of any annotation of ribosomal protein genes that are required for determining the preferred codons for codon adaptation index (CAI) estimation.

Genome-Wide Gene Expression Data

We used published E. coli gene expression data from the log growth phase obtained from a high-density oligonucleotide tiling array experiment ( Cho et al. 2009). To download all publicly available microarray expression data from other prokaryotes, we used the Stanford Microarray Database ( Hubble et al. 2009) that houses hundreds of expression data sets based on cDNA microarrays. Expression data from six species (Bacillus subtilis, ID: 66211 Campylobacter jejuni, ID: 28770 Helicobacter pylori, ID: 16576 Tuberculosis micobacteriana, ID: 14047 Salmonella typhimurium, ID: 23956 and Vibrio cholerae: ID 66211) were used in our analysis. We also used the NCBI Gene Expression Omnibus and downloaded the microarray data of Dehalococcoides ethenogenes (GSE 10185), Geobacter sulfurreducens (GSE 22511), Listeria monocytogenes (GSE 16336), and Streptococcus agalactiae (GSE 21564).

Synonymous Codon Usage Bias

To calculate the relative synonymous codon usage (RSCU) in a species ( Sharp and Li 1986), we used ribosomal protein genes, which are generally among the most highly expressed genes in a genome ( Sharp et al. 1986). Based on the RSCU values, the CAI was calculated for each gene in a genome ( Sharp and Li 1987). Briefly, CAI of a gene is the geometric mean of RSCU of all codons divided by the highest possible geometric mean of RSCU given the same amino acid sequence.

Classification of Informational Genes and Operational Genes

Following an earlier study ( Jain et al. 1999), we regarded genes annotated with “transcription,” “translation,” “DNA replication,” or any of their subterms in Gene Ontology ( Ashburner et al. 2000) as informational genes. All other genes were considered operational genes.

Protein–Protein Interactions

los E. coli protein–protein interaction data were retrieved from a recent publication ( Hu et al. 2009), in which 5,993 nonredundant pairwise physical interactions among 1,757 proteins were identified by an affinity-based method and genomic context-based inferences.

Análisis estadístico

We estimated the relative contributions of all predictors to the total variance in gene transferability by calculating the relative contribution of variability explained (RCVE) for each predictor using RCVE = 1 − R reduced 2 / R full 2 ⁠ , where R full 2 and R reduced 2 are the R 2 (square of the correlation coefficient) for the full linear model and the model without the predictor of interest, respectively ( Park and Makova 2009). To diagnose multicollinearity of each predictor, variance inflation factors (VIFs) ( Kutner et al. 2005) were calculated. All predictors in the model used had VIFs below 2, suggesting that multicollinearity did not adversely affect our model. Linear multiple regression analysis was performed in the R statistical package.


Materiales y métodos

Transcriptome and assemblies

We used the embryonic samples of Idiosepius y Nautilo as well as their adult tissues to capture regulatory genes critical for systemic development of the eye and lens across species. For embryonic eye transcriptomics (RNA-seq) analysis, we utilized assemblies (stage 25 embryos of the pygmy squid, Idiosepius paradoxus and 3-month-old embryos of the chambered nautilus, Nautilus pompilius ) obtained by Ogura et al. (2013) . For adult Idiosepius y Nautilo , we generated novel sets of RNA-seq data. Tissues of Idiosepius y Nautilo were removed and homogenized in TRIzol reagent (Invitrogen) immediately after the animals were sacrificed. To minimize possible nucleotide polymorphism, we utilized a single individual of Nautilo . However, due to small sizes of Idiosepius , we pooled tissues from several individuals. Total RNAs were isolated according to the manufacture’s protocol, followed by on column DNase treatment using a QIAGEN RNeasy kit. Qualities of the RNAs were tested by Agilent Nanodrop and Agilent 2100 bioanalyzer. The RNA samples were sent to the BGI Inc and short read sequences were obtained by Illumina Hiseq2000 according to the company’s procedures.

FASTQ sequences of Idiosepius o Nautilo were pooled into one dataset and were assembled using the Trinity platform ( Grabherr et al. 2011 ). To obtain normalized intensities of gene expression across tissues (fragments per kilobase per million reads, FPKM), reads from each sample was mapped onto the Trinity assembly with Bowtie ( Langmead et al. 2009 ) and analyzed with RSEM ( Li and Dewey 2011 ) and edgeR ( Robinson et al. 2010 ). In the assembly procedure, variants of putative alternative splicing (sub-components of the Trinity output) were estimated as different contigs, but we merged variants from one sub-component based on the “%comp_fpkm” values of edgeR output. Analytical pipelines on a NIG Cell Innovation program ( http://cell-innovation.nig.ac.jp/ ) were used with the annotation steps to the assembled contigs.

Data from the eyes of Idiosepius were assembled together with data from brain, arm, gonad, and gut. Contigs shorter than 500 bp and FPKM less than 1 were filtered out. Contigs that passed the criteria are used as “the eye genes”. Data from Nautilo eyes were assembled together with data from brain, arm, and siphuncule and processed in the same way. Sequence homology was tested using NCBI BLAST 2.2.30+ ( Camacho et al. 2008 ) after filtering out genes shorter than 500 bp to remove gene fragments having traceability. For comparative analysis, we obtained gene models from two gastropods, the sea hare Aplysia californica (AplCal3.0, GCF_000002075.1, July 2013) and the giant owl limpet Lottia gigantea (Lotgi1, INSDC Assembly GCA_000327385.1, January 2013) the Pacific oyster, Crassostrea gigas (oyster_v9, INSDC Assembly GCA_000297895.1, September 2012) the polychaete annelid, Capitella telata (Capitella teleta v1.0, INSDC Assembly GCA_000328365.1, December 2012) the fly, Drosophila melanogaster (BDGP6, INSDC Assembly GCA_000001215.4) and human (GRCh38, INSDC Assembly GCA_000001405.15, December 2013) from Ensembl. Eye transcriptome data from human fetuses were obtained from an EST analysis by Choy et al. (2006) . Choy et al. (2006) listed 4010 human gene models as the fetal eye genes using the previous human genome build. However, 669 genes were missing in the current human genome build (the Ensembl Human Build 38). To compensate, we obtained EST sequences from NCBI (BY794942-BY800475) and used these sequences in the search for homology.

Molecular phylogenetic analysis

The nucleotide sequences obtained in this study are available under the following accession numbers: [DDBJ: LC021432-LC021456] and listed in Supplementary Table S2 . For each set of genes (opsins, arrestins, and crystallins), we obtained 97, 16, and 31 sequences from the NCBI and made alignments together with 7, 3, and 14 cephalopod sequences found in this study, respectively. The NCBI accession numbers of the genes are shown in the respective figures.

We used MUSCLE on the EMBL-EBI Web Services to generate a multiple sequence alignment ( Edgar 2004 McWilliam et al. 2013 ). To remove poorly aligned sequences we used TrimAl v1.4.rev15 build[2013-12-17] with -gappyout option ( Capella-Gutierrez et al. 2009 ). Maximum-likelihood inference of phylogenetic trees was inferred using RAxML version 8.0.26 (-f a -No. 1000 -m PROTGAMMAGTR options were applied) ( Stamatakis 2014 ). One thousand bootstrap replicates were performed with the same search options as described above.

In situ hibridación

To generate Idiosepius Tbx20 DIG-labeled RNA targeted probes, we performed RT-PCR using the following primer set (F: ACCAGCCTCGAATTCACATC, R: GGAGGCCCAAATTAGGAAAG). To generate the Idiosepius cDNA, we utilized SMARTer RACE kit (Takara Clontech). The PCR fragments obtained from the RT-PCR were sub-cloned into T-vector (Promega) and used as templates for in vitro transcription using DIG RNA probe synthesis kit (Roche). Whole-mount en el lugar hybridization was performed using stage 25 embryos of Idiosepius according to the previously published protocol ( Yoshida et al. 2010 ).


Discusión

Linking Gene Expression and Phenotypic Traits

To advance our understanding of how molecular mechanisms allow organisms to adapt to and persist in altered environments, we linked gene coexpression networks with changes in phenotypic traits using resurrected Daphnia isolates separated by centuries of evolution and anthropogenic change. Network analyses allowed us to identify gene clusters and their networks that may underlie organismal responses to environmental shifts. To provide a direct phenotype–genotype link, we applied such a network approach and combined it with quantitative trait data observed in members of a single Daphnia population before and after a historic shift in nutrient supply associated with modern agricultural activities ( Frisch et al. 2014 Roy Chowdhury et al. 2015). Specifically, we explored the transcriptional regulation of two physiological traits related to P acquisition (RE and bP), and a higher order phenotypic trait dependent on RE and bP, that is, somatic GR, using a trait-associated gene coexpression network. The resulting network suggests a strong relationship of transcriptional responses with P-supply, with over 50% of the 17 observed modules significantly associated with the P-related phenotypic traits.

Our analysis identified distinct genes and pathways that were tied to individual phenotypic traits, and that are potential candidates for further exploration of their role in evolutionary adaptation to P enrichment.

Retention Efficiency

Two hubgenes of brown_RE belonged to the jumonji gene family that is known to regulate chromatin organization and thus gene expression ( Takeuchi et al. 2006). This finding suggests a certain degree of epigenetic regulation (previously described as DNA compaction in Daphnia Jalal et al. 2014) in RE. Overrepresentation of genes in purple_RE involved in amino acid metabolism (including trypsins) may indicate the exploitation of alternate P-sources under P-limitation as seen in plants ( Abel et al. 2002). One of the three top hubgenes was a MCO, a gene family essential for iron metabolism in many organisms ( Lang et al. 2012). Previous research in Daphnia identified a significant interaction between P-limitation and iron-kinetics ( Lind and Jeyasingh 2018). This finding, together with our results suggests a central role of MCOs in modulating essential cellular processes under P-limitation.

Body P

Regulation of body P might be necessary in order to counteract the effect of unusually high RE in ancient clones, and to retain cellular homeostasis, for example, by active release of inorganic P ( Rigler 1961) or moulting ( He and Wang 2007).

We speculate that the tan_bP genes highly expressed under HiP in ancient clones including many nonannotated genes (supplementary fig. S5c, Supplementary Material online) may contribute to the maintenance of defined bP concentrations when P is abundant. Regulation of bP may additionally be achieved by one of the hubenes of greenyellow_bP identified as a histone tail meythylase. Histone tail methylation has profound effects on gene transcription and can be passed transgenerationally in invertebrates, with the possibility of a long-lasting epigenetic memory of environmental conditions ( Klosin et al. 2017). Correlation of bP with genes involved in protein metabolism suggest that both ancient and modern genotypes are able to maintain homeostasis in body P-content in response to dietary P-supply by producing metabolic adjustments in P-usage.

Growth Rate

In contrast to the trait–module correlations of RE and bP, which were driven by evolutionary history (contrasting ancient or modern clones), GR module correlations were driven by treatment, with similar responses of ancient and modern clones, suggesting environmentally induced gene expression. The observed functional enrichment in signaling cascades involving transmitters and receptors indicates such environmental triggering of gene expression, particularly in azul_GR. According to the Growth Rate Hypothesis ( Main et al. 1997 Sterner and Elser 2002), GR is a trait that strongly depends on various molecular and physiological parameters controlling P-allocation to ribosomal RNA. Thus, when P supply in the environment is not limiting, these signaling cascades may lead to an increased rRNA biogenesis, thus increasing GR ( Sterner and Elser 2002). Coregulation of these genes by several transcription factors lends further support to this idea: genes controlled by the top three promoter motifs in each of the two modules reflect the same functional enrichment as the entire module ( fig. 3c). Notably, a large number of azul_GR genes are potentially coregulated by two or more promoter binding sites ( fig. 3c). Phosphoglycerate dehydrogenase, one of the lightgreen_GR hubgenes is crucial to L-serine biosynthesis, an amino acid central to cellular proliferation ( de Koning et al. 2003). One of the azul_GR hubgenes, carbonic anhydrase, is a zinc metalloenzyme involved in several biological processes such as the transport of CO2, maintaining acid-base balance, glycogen, and lipid synthesis ( Zolfaghari et al. 2014). Both enzymes therefore mediate multiple pathways that can play a significant role in regulating growth. Enriched gene families of azul_GR genes included signal transduction mechanisms, involving phosphodiesterases and phosphatases. These are known to be involved in P-scavenging in plants ( Plaxton and Tran 2011), but also in Daphnia (e.g., alkaline phosphatase McCarthy et al. 2010).

Evolution of Gene Expression Patterns and Networks

Adaptation to environmental change is typically associated with divergent gene expression patterns ( DeBiasse and Kelly 2016 Kenkel and Matz 2016 Sikkink et al. 2019). The trait-associated, transcriptional responses of ancient and modern Daphnia observed here support such findings ( fig. 2b), providing evidence of distinct evolved patterns of gene expression: constitutive gene expression (brown_RE), conserved gene expression plasticity (lightgreen_GR, azul_GR), and evolved plasticity (purple_RE, greenyellow_bP), sensu Renn and Schumer (2013). Given that the interaction of genes within modules is stronger than between modules, and that modules are regarded as “semi-independent” units that evolve independently due to reduced pleiotropic constraints ( Wagner et al. 2007 Snell‐Rood et al. 2010 Lotterhos et al. 2018), the coexistence of these observed gene expression patterns within a single network strongly supports the idea of individual evolutionary trajectories of these trait-associated modules.

Plastic gene expression in response to P-supply was common to almost all focal modules, but was not limited to ancient or modern clones ( fig. 2 and table 1). For example, RE correlated strongly with modules that showed signs of newly evolved plasticity (i.e., purple_RE). In contrast, genes in both GR-associated modules (i.e., azul_GR, lightgreen_GR) maintained similar gene expression plasticity in ancient and modern clones. While our data suggest that gene expression is often plastic, such plasticity did not always translate into similar plasticity in the tested phenotypic traits (e.g., GR): a plastic gene expression in ancient clones was less obvious in their phenotypic response. A potential explanation for this may be the complexity of this trait that depends on many other factors, including nutrient availability and assimilation, and other factors involved in cellular and developmental processes.

Complementing the trait-associated network, the use of network preservation statistics can identify the “wiring” of molecular mechanisms that are shared or divergent between ancient isolates and their modern counterparts ( Oldham et al. 2006). Our results highlight a highly preserved network structure with >70% of the ancient Daphnia modules preserved in modern descendants that was also reflected by shared gene regulatory mechanisms in ancient and modern modules (i.e., azulPres). Such a pattern is not unexpected in members of the same population, considering a similar level of preservation in closely related taxa that diverged from a common ancestor several million years ago (such as humans and chimpanzees Oldham et al. 2006). However, the analysis of network preservation also revealed patterns of evolutionary divergence of ancient Daphnia and their modern descendants in individual modules. In this context, the detection of a newly formed module (amarilloPres) in the modern Daphnia genotypes was especially striking. Such new modules provide evidence for evolutionary novelty on the level of transcription ( Oldham et al. 2006). Analysis of the gene expression pattern of amarilloPres revealed a plastic response of module members to P-availability, highlighting the role of gene expression plasticity in the evolutionary adaptation to P-supply. However, we found that in order to obtain detailed information about the evolutionary history of such plasticity, the consideration of network preservation statistics and resulting modules in isolation is insufficient. By integrating preservation and trait-associated networks, we were able to establish a link between the evolution of gene expression and phenotypic plasticity. Here, the presence of a high percentage of the amarilloPres genes in two trait-associated modules, purple_RE (“evolved plasticity”) and azul_GR (“conserved plasticity”) indicated the coexistence of different types of plasticity in a single module (here: amarilloPres), and that this plasticity may be associated with different traits.

Concluding Remarks

To genuinely advance the understanding of phenotypic evolution, comprehensive methods are required that consider entire organisms instead of single traits ( Forsman 2015). Such a holistic understanding is vital in order to predict evolutionary trajectories that result from major geochemical shifts that currently affect our planet, and is essential for the development of conservation strategies. The results presented here are a contribution toward such an understanding, and emphasize the need for an integrative approach that combines physiological and “omics data” in keystone species.

Genomic manifestation: theory predicts relaxed selection on loci underlying genetically controlled phenotypic plasticity and thus higher genomic variation in associated genes (Snell‐Rood et al. 2010). This raises the question whether the observed differences in gene expression between ancient and modern Daphnia clones are manifested in the genomic sequence, for instance as increased genetic divergence in modules with evolved plasticity.

Molecular regulators of phenotypic plasticity: while transcriptional regulation provides a critical mechanism for organisms to respond rapidly and efficiently to environmental change ( Turner 2009), the contribution of different molecular regulators of plasticity (e.g., epigenetic modifications, transcription factors) remain largely unknown and should be considered in future research.

Role of hubgenes: on a functional level, recent advantages in molecular techniques now allow for a detailed analysis of network structures to test if molecular cascades collapse when predicted hub-genes are modified via gene editing approaches (e.g., RNAi or CRISPr and Talen techniques Nakanishi et al. 2014 Naitou et al. 2015 Rivetti et al. 2018).

Contrasting resurrected members of populations that lived hundreds of years ago with their modern descendants, as done here, is a rare opportunity to track evolutionary trajectories in natural environments. Our study highlights the prospects of resurrection ecology when integrated with modern biology. It further emphasizes the applicability of this approach to numerous other organisms that produce dormant stages with long-term viability, and its significance for an in-depth understanding of evolutionary adaptation to global environmental change.


Resultados y discusión

Old-Biased Genes Are Not under Weaker Selection

Evolutionary theories of ageing predict weaker selection on genes which are expressed in old individuals due to low effective population size and reduced fecundity ( Kirkwood and Austad 2000 Flatt and Partridge 2018). In ant queens, we may expect a reduction of this “selection shadow” as low extrinsic mortality and lifelong, high fertility should lead to a stable effective population size up to old age. We tested this by estimating and comparing selection strength between three groups of genes. These were 1) old-biased genes norte = 46: significantly over-expressed in seven old (18 weeks) compared with seven young (4 weeks) C. obscurior queens 2) young-biased genes (norte = 96): significantly over-expressed in young compared with old queens 3) unbiased genes (norte = 2,616): no significant difference in expression between young and old queens. To estimate direction and strength of selection, we measured dnorte/DS (ratio of nonsynonymous to synonymous substitution rates) for one-to-one orthologs with a set of 10 ant species (see Materials and Methods). A dnorte/DS ratio ≈ 1 indicates neutral evolution, whereas values ≪ 1 signify purifying selection. We find no evidence for weaker purifying selection in old-aged queens, since dnorte/DS in old-biased genes (median: 0.084) is in fact significantly lower than in young-biased genes (median: 0.127 PAG value = 0.016 Mann–Whitney U test fig. 1), indicating increased purifying selection with age. This is in contrast to published results for age-biased genes in humans, in which old-biased genes had a significantly higher dnorte/DS (median: 0.22) than young-biased genes (median: 0.09, PAG = 1.4 × 10 – 50 ), as would be expected for a reduction in purifying selection with age ( Jia et al. 2018). This was confirmed by a further study on several mammalian tissues, in which an adjusted dnorte/DS metric correlated more strongly with expression in young compared with old individuals ( Turan et al. 2019). Interestingly, dnorte/DS in young-biased genes is also significantly higher than in unbiased genes (median: 0.100 PAG value = 2.2 × 10 −4 Mann–Whitney U test), as has previously been reported for the ant, Lasius niger ( Lucas et al. 2017). To further test the ability of this method to detect a selection shadow in insects, we repeated the analysis for D. melanogaster. Age-biased gene expression was measured for a novel data set containing expression data for young (10 days) and old (38 days) female flies across two tissues (head and fat body) and different feeding regimes. Evolutionary rates were obtained for these genes from published analyses based on alignments of 12 Drosophila species ( Clark et al. 2007). In contrast to our results for ant queens but in agreement with expectations for a selection shadow, we find significantly higher dnorte/DS levels in old-biased fly genes (median: 0.060) compared with young-biased genes (median: 0.047 PAG = 5.1 × 10 −8 Mann–Whitney U prueba).

Evolutionary rates (dnorte/DS) in genes with unbiased expression, young-biased, and old-biased expression in C. obscurior queens and D. melanogaster adult females. Significance was tested with Mann–Whitney U prueba.


Ver el vídeo: Clase 8. Genomas de Plantas y Bioinformática 1 (Agosto 2022).