Información

¿Herramienta para la alineación de nucleótidos con todos los códigos de nucleótidos (por ejemplo, R, Y, W, S, etc.)?

¿Herramienta para la alineación de nucleótidos con todos los códigos de nucleótidos (por ejemplo, R, Y, W, S, etc.)?


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Tengo una secuencia de vector y me gustaría encontrar la siguiente secuencia de nucleótidos en ella.

AASYWSRA

Esta secuencia de consulta utiliza varios símbolos degenerados, definidos como:

  • S = C o G (Strong)
  • Y = C o T (pYrimidina)
  • W = A o T (Weak)
  • R = A o G (puRine)

(Consulte esta página para obtener una descripción completa de los códigos de nucleótidos de la IUPAC).

¿Existe una herramienta para alinear esta secuencia con el vector y encontrar todos los sitios posibles?

EDITAR: Encontré este sitio web pero no pude encontrar ninguno de los recursos útiles. Tal vez uno de estos funcione, pero la mayoría de ellos me parecieron demasiado complicados. Si sabes cuál funcionará y explicas cómo usarlo te lo agradeceré.


Si está buscando una coincidencia exacta, realmente no necesita un alineador complejo. Las expresiones regulares de Perl son bastante poderosas en las transformaciones de cadenas o en la coincidencia condicional de subcadenas. Por ejemplo, para encontrar todas las coincidencias deAASYWSRAen una secuencia de nucleótidos$ seq, tu puedes hacer:

@matches = $ seq = ~ m / AA [CG] [CT] [AT] [CG] [AG] A / g;

los[]los corchetes se conocen como clases de caracteres Perl, que permiten diferentes caracteres en una posición.


Nunca he utilizado la función, pero sé que Vmatch le permite definir sus propios alfabetos y asignaciones de símbolos, lo que debería permitirle manejar los símbolos de nucleótidos ambiguos de la IUPAC. El alfabeto / mapeo predeterminado puede incluso incluir estos símbolos.


He usado MAST para buscar motivos particulares en una secuencia.

Desde la página de introducción de MAST, parece que tendrá que reformatear un poco su motivo, pero debería ser suficiente para sus propósitos:

Los motivos se representan como matrices de puntuación dependientes de la posición que describen la puntuación de cada letra posible en cada posición del patrón.

Aquí hay más información sobre el formato, que también indica que el alfabeto que usa se interpretará correctamente.


¿Herramienta para la alineación de nucleótidos con todos los códigos de nucleótidos (por ejemplo, R, Y, W, S, etc.)? - biología

Primer-BLAST se diseñó para fabricar cebadores específicos para una plantilla de PCR de entrada, utilizando Primer3. También puede comprobar la especificidad de los cebadores proporcionados por el usuario.

Las páginas de nucleótidos y proteínas "Búsqueda de coincidencias breves y casi exactas" ya no existen. En cambio, los programas de explosión de nucleótidos y proteínas comprueban automáticamente las consultas breves y ajustan los parámetros de búsqueda en consecuencia. Este ajuste se produce cuando la consulta, ya sea nucleótido o aminoácido, tiene una longitud de 30 o menos. Los programas de explosión de traducción o las búsquedas en las páginas de explosión del genoma no tienen esta función de ajuste automático.

P: Base de datos predeterminada para búsquedas de nucleótidos-nucleótidos

P: Guardar sus parámetros de búsqueda

P: Cómo limitar una búsqueda a un organismo o grupo taxonómico o excluir dichos grupos

Para buscar solo secuencias de un organismo o grupo taxonómico, use el cuadro de texto "Organismo". En las páginas de explosión de nucleótidos, primero haga clic en el botón de opción "Otros (nr, etc.)". El cuadro de texto "Organismo" tiene una función de autocompletar. Comience a ingresar el nombre común de un organismo (rata, bacteria, etc.), un género o especie (elegans, danio, etc.) o una identificación de taxonomía NCBI y luego seleccione un nombre de la lista.

El grupo taxonómico también se puede excluir utilizando la casilla de verificación "Excluir" a la derecha de la casilla "Organismo".

Se pueden incluir o excluir más grupos taxonómicos con el cuadro "+" más a la derecha del cuadro de texto "Organismo".

También puede utilizar los términos de Entrez Query como antes. Colóquelos en el cuadro Consulta de Entrez justo debajo del campo Organismo, por ejemplo, rattus norvegicus [organismo] o simplemente, rat [orgn]. Además, consulte las preguntas frecuentes, "Cómo limitar una búsqueda a un subconjunto de secuencias de bases de datos".

Puede buscar taxones en el navegador de taxonomía.

P: ¿Cómo excluir modelos (accesiones XM / XP) y secuencias ambientales no cultivadas?

P: ¿Cómo limitar una búsqueda a un subconjunto de secuencias de bases de datos?

P: ¿Cómo puedo buscar un lote de secuencias con BLAST?

    1.) Ejecutables BLAST independientes. Estos son programas de línea de comando que ejecutan búsquedas BLAST contra copias locales descargadas de las bases de datos NCBI BLAST o contra bases de datos personalizadas formateadas para BLAST. Los programas manejarán un solo archivo grande con múltiples secuencias de consulta FASTA, o puede crear un script para enviar múltiples archivos uno a la vez. Los ejecutables están disponibles para una amplia variedad de plataformas, incluidas LINUX, Windows y Mac OSX.

P: Cómo usar BLAST para alinear dos secuencias sin una búsqueda en la base de datos.

P: ¿Cuál es el valor esperado (E)?

El valor esperado (E) es un parámetro que describe el número de aciertos que uno puede "esperar" ver por casualidad cuando se busca en una base de datos de un tamaño particular. Disminuye exponencialmente a medida que aumenta la puntuación (S) del partido. Esencialmente, el valor E describe el ruido de fondo aleatorio. Por ejemplo, un valor E de 1 asignado a un acierto puede interpretarse en el sentido de que en una base de datos del tamaño actual uno podría esperar ver 1 coincidencia con una puntuación similar simplemente por casualidad.

Cuanto menor sea el valor E, o cuanto más cerca esté de cero, más "significativa" será la coincidencia. Sin embargo, tenga en cuenta que las alineaciones cortas prácticamente idénticas tienen valores de E relativamente altos. Esto se debe a que el cálculo del valor E tiene en cuenta la longitud de la secuencia de consulta. Estos valores altos de E tienen sentido porque las secuencias más cortas tienen una mayor probabilidad de aparecer en la base de datos por pura casualidad. Para obtener más detalles, consulte los cálculos en el curso BLAST.

El valor Expect también se puede utilizar como una forma conveniente de crear un umbral de importancia para informar los resultados. Puede cambiar el umbral del valor esperado en la mayoría de las páginas de búsqueda BLAST. Cuando el valor de Esperar aumenta desde el valor predeterminado de 10, se puede informar una lista más grande con más aciertos de puntuación baja.

¿Qué es la secuencia de "baja complejidad"?

Las regiones con secuencia de baja complejidad tienen una composición inusual que puede crear problemas en la búsqueda de similitud de secuencia. Para las consultas de aminoácidos, este sesgo de composición está determinado por el programa SEG (Wootton y Federhen, 1996). Para consultas de nucleótidos, se determina mediante el programa DustMasker (Morgulis, et al., 2006).

La secuencia de baja complejidad a menudo se puede reconocer mediante inspección visual. Por ejemplo, la secuencia de proteínas PPCDPPPPPKDKKKKDDGPP tiene baja complejidad y también la secuencia de nucleótidos AAATAAAAAAAATAAAAAAT. Los filtros se utilizan para eliminar la secuencia de baja complejidad porque puede provocar aciertos de artefactos.

En las búsquedas BLAST realizadas sin un filtro, los resultados de alta puntuación se pueden informar solo debido a la presencia de una región de baja complejidad. Muy a menudo, es inapropiado considerar este tipo de coincidencia como el resultado de una homología compartida. Más bien, es como si la región de baja complejidad fuera "pegajosa" y extrajera muchas secuencias que no están realmente relacionadas.

¿Cómo filtrar las repeticiones intercaladas (específicas del organismo)?


¿Herramienta para la alineación de nucleótidos con todos los códigos de nucleótidos (por ejemplo, R, Y, W, S, etc.)? - biología

Un manual completo sobre el kit de herramientas de NCBI C ++, que incluye su marco de diseño y desarrollo, una referencia de biblioteca de C ++, ejemplos de software y demostraciones, preguntas frecuentes y notas de la versión. El manual se puede buscar en línea y se puede descargar como una serie de documentos PDF.

Descargas

Los ejecutables BLAST para uso local se proporcionan para los sistemas Solaris, LINUX, Windows y MacOSX. Consulte el archivo README en el directorio ftp para obtener más información. Las bases de datos preformateadas para BLAST nucleótidos, proteínas y búsquedas traducidas también están disponibles para su descarga en el subdirectorio db.

Secuencia de bases de datos para su uso con los programas BLAST independientes. Los archivos de este directorio son bases de datos formateadas previamente que están listas para usarse con BLAST.

Este sitio proporciona registros de datos completos para CDD, junto con matrices de puntuación específicas de posición (PSSM) individuales, secuencias mFASTA y datos de anotación para cada dominio conservado. Consulte el archivo README para obtener todos los detalles.

Este sitio proporciona extracciones de datos completos en XML y datos resumidos en formato VCF. Contiene archivos con información sobre términos estándar utilizados en ClinVar, MedGen y GTR.

Secuencia de bases de datos en formato FASTA para usar con los programas BLAST independientes. Estas bases de datos deben formatearse usando formatdb antes de que puedan usarse con BLAST.

Este sitio contiene archivos para todos los registros de secuencia en GenBank en el formato de archivo plano predeterminado. Los archivos están organizados por división GenBank y el contenido completo se describe en el archivo README.genbank.

Las secuencias de proteínas correspondientes a las traducciones de secuencias codificantes (CDS) en GenBank se recopilan para cada versión de GenBank. Consulte el archivo README en el directorio para obtener más información.

Este sitio contiene tres directorios: DATA, GeneRIF y herramientas. El directorio DATA contiene archivos que enumeran todos los datos vinculados a GeneID junto con subdirectorios que contienen datos ASN.1 para los registros de genes. El directorio GeneRIF (Gene References into Function) contiene identificadores de PubMed para artículos que describen la función de un solo gen o las interacciones entre productos de dos genes. En el directorio de herramientas se proporcionan ejemplos de programas para manipular datos genéticos. Consulte el archivo README para obtener más detalles.

Este sitio contiene datos GEO en dos formatos: SOFT (Omnibus simple en formato de texto) y MINiML (Notación MIAME en lenguaje de marcado). También se encuentran disponibles archivos de texto resumidos y datos complementarios. Consulte el archivo README.TXT para obtener más información.

Este sitio contiene la secuencia del genoma y los datos de mapeo de los organismos en Entrez Genome. Los datos están organizados en directorios para especies individuales o grupos de especies. Los datos cartográficos se recopilan en el directorio MapView y están organizados por especies. Consulte el archivo README en el directorio raíz y los archivos README en los subdirectorios de especies para obtener información detallada.

Contiene directorios para cada genoma que incluyen datos de mapeo disponibles para compilaciones actuales y anteriores de ese genoma.

Este sitio contiene la base de datos de taxonomía completa junto con archivos que asocian registros de secuencias de nucleótidos y proteínas con sus ID de taxonomía. Consulte los archivos taxdump_readme.txt y gi_taxid.readme para obtener más información.

Este sitio proporciona datos de las bases de datos de sustancias, compuestos y bioensayos de PubChem para su descarga a través de ftp. Las descargas completas de las bases de datos están disponibles junto con actualizaciones diarias, semanales y mensuales para Sustancias y Compuestos. Los datos de sustancias y compuestos se proporcionan en formatos ASN.1, SDF y XML. Consulte los archivos README para obtener más información.

Este sitio contiene todos los registros de secuencias de nucleótidos y proteínas de la colección de secuencias de referencia (RefSeq). El directorio "" release "" contiene la versión más actual de la colección completa, mientras que los datos de organismos seleccionados (como humanos, ratones y ratas) están disponibles en directorios separados. Los datos están disponibles en FASTA y formatos de archivo plano. Consulte el archivo README para obtener más detalles.

Este sitio contiene datos SKY-CGH en formatos ASN.1, XML y EasySKYCGH. Consulte el archivo skycghreadme.txt para obtener más información.

Datos descargables para SNP.

Este sitio contiene datos de secuenciación de próxima generación organizados por el proyecto de secuenciación presentado.

Sitio de descarga FTP para bases de datos, herramientas y utilidades de NCBI.

Este sitio contiene datos ASN.1 para todos los registros en MMDB junto con datos de alineación VAST y conjuntos de datos PDB no redundantes (nr-PDB). Consulte el archivo README para obtener más información.

Este sitio contiene los datos del cromatograma de trazas organizados por especies. Los datos incluyen cromatogramas, puntuaciones de calidad, secuencias FASTA de llamadas de bases automáticas y otra información auxiliar en texto delimitado por tabulaciones, así como en formatos XML. Consulte el archivo README para obtener más detalles.

Este sitio contiene las bases de datos UniVec y UniVec_Core en formato FASTA. Consulte el archivo README.uv para obtener más detalles.

Este sitio contiene datos de secuencia de escopeta de genoma completo organizados por el código de proyecto de 4 dígitos. Los datos incluyen archivos planos GenBank y GenPept, puntajes de calidad y estadísticas resumidas. Consulte el archivo README.genbank.wgs para obtener más información.

Los datos de acceso abierto generalmente incluyen resúmenes de estudios de asociación de genotipo / fenotipo, descripciones de las variables medidas y documentos de estudio, como el protocolo y los cuestionarios. El acceso a datos a nivel individual, incluidas tablas de datos fenotípicos y genotipos, requiere distintos niveles de autorización.

Las especificaciones para los datos NCBI en formato ASN.1 o DTD están disponibles en la página Índice de especificaciones de datos. Los enlaces "NCBI_data_conversion.html" a la herramienta de conversión.

Un conjunto de conjuntos de etiquetas para crear y archivar artículos de revistas, así como para transferir artículos de revistas de editoriales a archivos y entre archivos. Hay cuatro conjuntos de etiquetas: Conjunto de etiquetas de archivo e intercambio: creado para permitir que un archivo capture tantos componentes estructurales y semánticos del material de revistas impreso y etiquetado existente de la manera más conveniente posible Conjunto de etiquetas de publicación de revistas: optimizado para archivos que desean regularizar y controlar su contenido, no aceptar la secuencia y el arreglo que les presente un editor en particular. Conjunto de etiquetas de autoría de artículos: diseñado para la creación de nuevos artículos de revistas Conjunto de etiquetas de libros NCBI: escrito específicamente para describir volúmenes para las bibliotecas en línea de NCBI.

Este servicio permite a los usuarios descargar registros de compuestos o sustancias correspondientes a un conjunto de identificadores de PubChem, que se pueden suministrar manualmente o mediante un archivo de texto. Hay disponibles numerosos formatos de descarga, incluidos SDF, XML y SMILES.

Suscríbase a las fuentes Web / RSS para obtener actualizaciones sobre los recursos del NCBI.

Envíos

Un formulario en línea que proporciona una interfaz para que investigadores, consorcios y organizaciones registren sus Bioproyectos. Esto sirve como punto de partida para la presentación de datos genómicos y genéticos para el estudio. No es necesario enviar los datos en el momento del registro del Bioproyecto.

Una herramienta de envío de secuencias basada en la web para uno o algunos envíos a la base de datos de GenBank, diseñada para hacer que el proceso de envío sea rápido y fácil.

Herramienta para enviar a la base de datos GenBank de secuencias de nucleótidos cortas de código de barras de un locus genético estándar para su uso en la identificación de especies.

Una herramienta de software independiente desarrollada por NCBI para enviar y actualizar entradas a bases de datos de secuencias públicas (GenBank, EMBL o DDBJ). Es capaz de manejar presentaciones simples que contienen una única secuencia corta de ARNm, presentaciones complejas que contienen secuencias largas, anotaciones múltiples, conjuntos segmentados de ADN, así como secuencias de estudios filogenéticos y de población con alineamientos. Para un envío simple, utilice la herramienta de envío en línea BankIt.

Un programa de línea de comandos que automatiza la creación de registros de secuencia para enviarlos a GenBank utilizando muchas de las mismas funciones que Sequin. Se utiliza principalmente para la presentación de genomas completos y grandes lotes de secuencias.

Envíe datos de expresión, como microarrays, SAGE o conjuntos de datos de espectrometría de masas a la base de datos NCBI Gene Expression Omnibus (GEO).

Este sitio permite a los usuarios enviar datos a las bases de datos de PubChem Substance y BioAssay, incluidas estructuras químicas, resultados de actividad biológica experimental, anotaciones, datos de ARNip y más. También se puede utilizar para actualizar registros enviados previamente.

La página de herramientas de la base de datos de SNP proporciona enlaces a las pautas generales de presentación y a la solicitud de manejo de presentación. La página también tiene dos enlaces específicos para envíos únicos o por lotes de los datos de variación humana utilizando la nomenclatura de la Sociedad de Variación del Genoma Humano.

Un único punto de entrada para que los remitentes se vinculen y encuentren información sobre todos los procesos de envío de datos en NCBI. Actualmente, esto sirve como una interfaz para el registro de bioproyectos y muestras biológicas y el envío de datos para WGS y GTR. Se planean adiciones futuras a este sitio.

Este enlace describe cómo los remitentes de datos de seguimiento pueden obtener un sitio FTP seguro de NCBI para sus datos, y también describe los formatos de datos permitidos y las estructuras de directorio.

Instrumentos

Realiza una búsqueda BLAST de secuencias similares de genomas eucarióticos y procarióticos completos seleccionados.

Realiza una búsqueda BLAST de las secuencias genómicas en el conjunto RefSeqGene / LRG. La pantalla predeterminada proporciona una navegación lista para revisar las alineaciones en la pantalla de gráficos.

Encuentra regiones de similitud local entre secuencias biológicas. El programa compara secuencias de nucleótidos o proteínas con bases de datos de secuencias y calcula la significación estadística de las coincidencias. BLAST se puede utilizar para inferir relaciones funcionales y evolutivas entre secuencias, así como para ayudar a identificar miembros de familias de genes.

Le permite recuperar registros de muchas bases de datos de Entrez cargando un archivo de IG o números de acceso de las bases de datos de nucleótidos o proteínas, o un archivo de identificadores únicos de otras bases de datos de Entrez. Los resultados de la búsqueda se pueden guardar en varios formatos directamente en un archivo local en su computadora.

Una aplicación independiente para clasificar secuencias de proteínas e investigar sus relaciones evolutivas. CDTree puede importar, analizar y actualizar registros y jerarquías de Dominios Conservados (CDD) existentes, y también permite a los usuarios crear los suyos propios. CDTree está estrechamente integrado con Entrez CDD y Cn3D, y permite a los usuarios crear y actualizar alineaciones de dominios de proteínas.

COBALT es una herramienta de alineación de secuencias múltiples de proteínas que encuentra una colección de restricciones por pares derivadas de la base de datos de dominios conservados, la base de datos de motivos de proteínas y la similitud de secuencias, utilizando RPS-BLAST, BLASTP y PHI-BLAST.

Una aplicación independiente para ver estructuras tridimensionales del servicio de recuperación Entrez de NCBI. Cn3D se ejecuta en Windows, Macintosh y UNIX y se puede configurar para recibir datos de los navegadores web más populares. Cn3D muestra simultáneamente la estructura, la secuencia y la alineación, y tiene potentes funciones de edición de anotaciones y alineaciones.

Identifica los dominios conservados presentes en una secuencia de proteínas. CD-Search utiliza RPS-BLAST (Reverse Position-Specific BLAST) para comparar una secuencia de consulta con matrices de puntuación específicas de posición que se han preparado a partir de alineaciones de dominios conservados presentes en la base de datos de dominios conservados (CDD).

Herramientas que brindan acceso a datos dentro del sistema Entrez de NCBI fuera de la interfaz de consulta web regular. Proporcionan un método para automatizar las tareas de Entrez dentro de las aplicaciones de software. Cada utilidad realiza una tarea de recuperación especializada y se puede utilizar simplemente escribiendo una URL con formato especial.

Herramienta para alinear una secuencia de consulta (nucleótido o proteína) con secuencias GenBank incluidas en microarrays o plataformas SAGE en la base de datos GEO.

Esta herramienta compara secuencias de nucleótidos o proteínas con bases de datos de secuencias genómicas y calcula la significación estadística de las coincidencias mediante el algoritmo de la herramienta de búsqueda de alineación local básica (BLAST).

La herramienta Remap de NCBI permite a los usuarios proyectar datos de anotaciones y convertir ubicaciones de características de un ensamblaje genómico a otro o en secuencias RefSeqGene a través de un análisis base por base. Se proporcionan opciones para ajustar el rigor de la reasignación y los resultados resumidos se muestran en la página web. Los resultados completos se pueden descargar para verlos en el visor gráfico Genome Workbench de NCBI, y los datos de anotación para las funciones reasignadas, así como los datos resumidos, también están disponibles para descargar.

Una aplicación integrada para ver y analizar datos de secuencia. Con Genome Workbench, puede ver datos en bases de datos de secuencias disponibles públicamente en NCBI y mezclar estos datos con sus propios datos.

Una aplicación web interactiva que permite a los usuarios visualizar múltiples alineaciones creadas por los resultados de búsqueda de la base de datos u otras aplicaciones de software. MSA Viewer permite a los usuarios cargar una alineación y establecer una secuencia maestra, y explorar los datos utilizando funciones como el zoom y el cambio de coloración.

Un conjunto de especificaciones de intercambio de datos y software utilizado por NCBI para producir software modular portátil para biología molecular. El software de Toolbox está diseñado principalmente para leer registros en formato de notación de sintaxis abstracta 1 (ASN.1), un formato de representación de datos de la Organización Internacional de Normalización (ISO).

Un paquete de software de control de calidad de dominio público que facilita la evaluación de perfiles de ADN de repetición múltiple corta en tándem (STR) basados ​​en protocolos específicos de laboratorio. OSIRIS evalúa los datos de electroforesis sin procesar utilizando un algoritmo de dimensionamiento basado en matemáticas derivado de forma independiente. Ofrece dos nuevas medidas de máxima calidad: nivel de ajuste y tamaño residual. Puede personalizarse para adaptarse a firmas específicas de laboratorio, como configuraciones de ruido de fondo, convenciones de nomenclatura personalizadas y controles de laboratorio internos adicionales.

Una herramienta de análisis gráfico que encuentra todos los marcos de lectura abiertos en la secuencia de un usuario o en una secuencia que ya está en la base de datos. Se pueden utilizar dieciséis códigos genéticos diferentes. La secuencia de aminoácidos deducida se puede guardar en varios formatos y buscar en bases de datos de proteínas usando BLAST.

La herramienta Primer-BLAST utiliza Primer3 para diseñar cebadores de PCR para una plantilla de secuencia. Luego, los productos potenciales se analizan automáticamente con una búsqueda BLAST contra bases de datos especificadas por el usuario, para verificar la especificidad del objetivo deseado.

Una utilidad para calcular el alineamiento de proteínas con la secuencia de nucleótidos genómicos. Se basa en una variación del algoritmo de alineación global de Needleman Wunsch y tiene en cuenta específicamente los intrones y las señales de empalme. Debido a este algoritmo, ProSplign es preciso para determinar los sitios de empalme y tolera los errores de secuenciación.

PUG proporciona acceso a los servicios de PubChem a través de una interfaz programática. PUG permite a los usuarios descargar datos, iniciar búsquedas de estructuras químicas, estandarizar estructuras químicas e interactuar con las utilidades electrónicas. Se puede acceder a PUG mediante URL estándar o mediante SOAP.

La estandarización, en la terminología de PubChem, es el procesamiento de estructuras químicas de la misma manera que se usa para crear registros de PubChem Compound a partir de las estructuras originales de los contribuyentes. Este servicio permite a los usuarios ver cómo PubChem manejaría cualquier estructura que les gustaría enviar.

La búsqueda de estructura de PubChem permite consultar la base de datos de compuestos de PubChem por estructura química o patrón de estructura química. PubChem Sketcher permite dibujar una consulta manualmente. Los usuarios también pueden especificar la entrada de la consulta estructural mediante PubChem Compound Identifier (CID), SMILES, SMARTS, InChI, Fórmula molecular o mediante la carga de un formato de archivo de estructura compatible.

Hay una variedad de herramientas disponibles para buscar en la base de datos de SNP, lo que permite la búsqueda por genotipo, método, población, remitente, marcadores y similitud de secuencia usando BLAST. Estos están vinculados bajo "" Buscar "" en la barra lateral izquierda de la página principal de dbSNP.

Proporciona una visualización gráfica configurable de una secuencia de nucleótidos o proteínas y características que se han anotado en esa secuencia. Además de usarse en las páginas de la base de datos de secuencias de NCBI, este visor está disponible como un componente de página web integrable. La documentación detallada que incluye una guía de referencia de la API está disponible para los desarrolladores que deseen integrar el visor en sus propias páginas.

Una utilidad para calcular alineamientos de secuencias de ADNc a genómico. Se basa en una variación del algoritmo de alineación global Needleman-Wunsch y tiene en cuenta específicamente los intrones y las señales de empalme. Debido a este algoritmo, Splign es preciso para determinar los sitios de empalme y tolera los errores de secuenciación.

Una herramienta para crear y mostrar datos de árboles filogenéticos. Tree Viewer permite el análisis de sus propios datos de secuencia, produce imágenes vectoriales imprimibles como archivos PDF y se puede incrustar en una página web.

Un sistema para identificar rápidamente segmentos de una secuencia de ácido nucleico que puede ser de origen vectorial. VecScreen busca en una secuencia de consulta segmentos que coincidan con cualquier secuencia en una base de datos de vectores no redundante especializada (UniVec).

Un algoritmo informático que identifica estructuras tridimensionales de proteínas similares. Los vecinos de estructura para cada estructura en MMDB están precalculados y accesibles a través de enlaces en las páginas de Resumen de estructura de MMDB. Estos vecinos se pueden utilizar para identificar homólogos distantes que no pueden reconocerse únicamente mediante comparación de secuencias.


3 ESTUDIO DE CASO

Desarrollamos y validamos este paquete con tres conjuntos de datos: (1) Saccharomyces cerevisiae (Burke, Liti y Long, 2014), (2) Ictalurus furcatus (Li, Waldbieser, et al., 2014) y (3) Drosophila pseudoobscura (McGaugh y Noor, 2011 Stevison et al., 2017). Nosotros usamos S. cerevisiae para el diseño de marcadores VCF de poblaciones múltiples. Nosotros usamos I. furcatus archivos de diseño de marcadores y resultados de secuenciación para refinar el flujo de trabajo (Figura 1c). Finalmente, usamos dos cepas de D. pseudoobscura para desarrollar el genotipo R, que discutimos en detalle a continuación. Primero, descargamos lecturas sin procesar del archivo de lectura corta de NCBI (Kodama, Shumway y Leinonen, 2011) (Flagstaff14 / 16: SRR330100 / SRR330102) (McGaugh y Noor, 2011). Estos se alinearon con la referencia dp4 (UCSC, 2017a) con bwa (Li y Durbin, 2009). En segundo lugar, los archivos de alineación se analizaron con la canalización de mejores prácticas de GATK produciendo un archivo VCF que incluye bases de referencia (McKenna et al., 2010) y genotipos binarios. En tercer lugar, inspeccionamos las distribuciones de anotaciones para aplicar un filtrado estricto (Tabla S1) y usamos archivos VCF para diseñar marcadores con Marcadores de secuencia. Se utilizó un flujo de trabajo muy similar para generar el archivo VCF de población de levadura de muestras múltiples. Para estudios sin un genoma de referencia, recomendamos mapear lecturas sin procesar a una referencia ensamblada (Figura 1b) y usar el archivo VCF resultante en nuestro flujo de trabajo. Luego, los estudios con datos de baja cobertura, como GBS (Li, Waldbieser, et al., 2014), RAD-seq o captura de secuencia, podrían usarse para diseñar marcadores de genotipado.

En nuestro caso de estudio, el paso de diseño de marcadores produjo 8.992 marcadores posibles de una región de 43,32 Mb. Reducimos nuestros marcadores a un subconjunto de marcadores C. 1 Mb de distancia. Luego usamos el software propietario de Sequenom para determinar la idoneidad del multiplex (Gabriel et al., 2009), e iteramos hasta que quedaron 35 marcadores. Muchos marcadores en ubicaciones similares facilitaron la iteración del conjunto de marcadores para la optimización de marcadores multiplexados. Finalmente, se completó la genotipificación, los datos fueron QA / QC y se calculó la tasa de recombinación con genotypeR como se describe anteriormente. Los conjuntos de datos 1 y 3 se proporcionan como datos de ejemplo de paquete.

3.1 Eficacia del marcador

Desarrollamos marcadores para distinguir las dos cepas en nuestro diseño de BC. Para validar los marcadores deben ser heterocigotos en las hembras F1 (89% validado). Para investigar el 11%, examinamos los umbrales de filtrado asociados con las llamadas base GATK. Nuestro análisis no logró identificar patrones específicos relacionados con el filtrado. No obstante, un enfoque más estricto ha dado como resultado un 99% de éxito en otros lugares (Weinman et al., 2014). Por lo tanto, sugerimos un filtrado de variantes estricto antes del diseño del marcador.


Resultados

Alfavirus

Primero, aplicamos cRegions y synplot2 en las 24 poliproteínas no estructurales de alfavirus (ver también el ejemplo de "conjunto de datos de alfavirus" en la página de inicio de cRegions). Detectamos un total de seis señales significativas con cRegions (Fig. 1A) y tres señales significativas con el synplot2 (Figs. S4A y S5A). La primera señal del extremo 5 'fue reconocida por ambos programas (Fig. 1A) y se extendió desde las posiciones 138 a 174 en la alineación de codones (Tabla 1). Es un elemento de secuencia conservada (CSE) llamado "CSE de 51 nt", que actúa como un potenciador de la síntesis de ARN, afectando la replicación viral. Este CSE forma dos bucles de tallo y está ubicado en las posiciones 155-205 en el genoma del virus Sindbis (SINV) (Niesters & amp Strauss, 1990). Por tanto, la señal detectada se encuentra exactamente en la región (Tabla 1).

Figura 1: Análisis de regiones de poliproteínas no estructurales de alfavirus utilizando la prueba de bondad de ajuste de Chi-cuadrado.

Señal Descripción Conjunto de datos Posición en la alineación del codón SFV * SINV *
Poliproteína no estructural 1 51 nt CSE Todos (Fig. 1A) 138–174 184–220 161–197
2 Señal adyacente a la región de unión de la cápside Todos (Fig. 1A) 1,149 N / A 1,148
Nuevo mundo (Fig. 1B) 1.086 y 1.092 N / A 1.142 y 1.148
3 Señal de empaquetado de alfavirus del complejo SFV Todos (Fig. 1A) 2,835 2,812 2,804
Complejo SFV (figura 1C) 2,730 2,812 2,804
4 Señal dentro de la región b Todos (Fig. 1A) 2,967 2,944 2,936
5 Señal adyacente al codón de parada con fugas Todos (Fig. 1A) 6,834 5,536 5,768
Nuevo mundo (Fig. 1B) 6,159 N / A 5,888
6 Promotor subgenómico de alfavirus Todos (Fig. 1A) 8.658 y 8.664 7.354 y 7.360 7.583 y 7.589
Poliproteína estructural 1 Motivo UUUUUUA Todos (Fig.2) 2,673–2,679 9,825–9,831 10,022–10,028

El segundo impacto significativo, un solo nucleótido en la posición 1.149, fue detectado solo por el algoritmo cRegions. Sin embargo, dos posiciones adyacentes 1.143 y 1.146 estaban justo por debajo del umbral. En el conjunto de datos de alfavirus del Nuevo Mundo, además de la posición 1.149, 1.143 también fue significativa. La señal es adyacente a la señal de empaquetamiento de SINV y alfavirus del Nuevo Mundo (ver también el ejemplo de "Conjunto de datos de alfavirus del Nuevo Mundo" en la página de inicio de cRegions). Se ha demostrado que un fragmento de 570 nt posiciones 684-1,253 del SINV se une a la proteína de la cápside viral y es necesario para el empaquetamiento de SINV. La señal detectada se encuentra en esta región (Weiss et al., 1989). Sin embargo, cuando analizamos los VEEV por separado, pudimos detectar las posiciones de los vástagos previstos filogenéticamente conservados (Fig. S7). Los resultados son similares al trabajo realizado por Kim et al. (2011).

La tercera y la cuarta señal también son nucleótidos únicos en las posiciones 2.835 y 2.967, respectivamente (Fig. 1A). Ambas señales están ubicadas dentro de la región conservada de nsp2 llamada región b. Esta región de 266 nucleótidos se encuentra entre 2726 y 2991 en el genoma de SFV (White, Thomson & amp Dimmock, 1998). El análisis previo de mutación por deleción ha demostrado que se requieren nucleótidos de 2.767 a 2.824 en la región b para el empaquetamiento eficiente del genoma del SFV. (White, Thomson y Dimmock, 1998). La primera señal se encuentra en esa región. Además, el análisis de los virus "SFV Complex" por separado condujo a una mayor importancia de la primera señal (Fig. 1C) y la misma señal se hizo visible con synplot2 (Figs. S4B y S5B). Como era de esperar, ambas señales desaparecieron en el conjunto de datos del Nuevo Mundo, ya que la señal de empaquetamiento se encuentra en una ubicación diferente en estos virus (Fig. 1B). Por lo tanto, dividir los conjuntos de datos en diferentes subconjuntos puede ayudar a detectar señales que solo son características de subgrupos más pequeños.

El quinto impacto significativo es un solo nucleótido en la posición 6.834. Es aguas abajo del codón de parada "con fugas" (el codón de parada está en 6,814-6,816 en la alineación del codón y en el genoma SINV en nt 5,748-5,750). Synplot2 pudo detectar una región mucho más grande en comparación con las cRegions en la misma área (Figs. S4A y S5A). La señal detectada es una estructura secundaria de ARN de tallo-bucle 3 'inmediatamente adyacente al codón de terminación (+13 nt aguas abajo del codón de terminación en SINV). Para muchos alfavirus, incluidos VEEV y SINV, se ha informado que influye en la lectura. En el genoma SINV, se predice que la parte de doble hélice (el tallo) del tallo-bucle se forma entre las dos regiones: 5.763–5.772 y 5.928–5.939 (Firth et al., 2011). Por lo tanto, la señal detectada en la posición 6.834 (5.768 en SINV) está dentro de la primera región. Sin embargo, cuando analizamos los VEEV por separado, pudimos detectar múltiples señales significativas dentro de esta región de tallo-bucle (Fig. S7).

La sexta señal consta de dos posiciones 8658 y 8664 en la alineación de codones (figura 1A, figuras S4A y S5A). La señal se encuentra dentro del promotor subgenómico de alfavirus (Raju & amp Huang, 1991 Rupp et al., 2015).

Las cRegions y synplot2 también se aplicaron a las poliproteínas estructurales de los alfavirus (ver también el ejemplo de "conjunto de datos estructurales de alfavirus" en la página de inicio de cRegions). Se utilizó una ventana corrediza de tamaño 2 con cRegions. Se detectó una señal fuerte en las posiciones 2.643-2.649 en la alineación del codón, que corresponde a un motivo UUUUUUA (Fig. 2). El motivo es responsable de un cambio de marco en una proteína estructural (Firth et al., 2008 Chung, Firth & amp Atkins, 2010). Se detectó la misma señal con el synplot2 (Fig. S6).

Figura 2: Análisis de regiones de poliproteínas estructurales de alfavirus.

Requisitos sobre secuencias

El método utilizado en cRegions tiene algunas limitaciones y requisitos previos (Puustusmaa & amp Abroi, 2016). Primero, las secuencias en estudio deben haber divergido. En segundo lugar, el elemento funcional incorporado debe haber sido seleccionado. Para ayudar a los usuarios a evaluar sus secuencias en estos aspectos, agregamos una versión interactiva de la Fig. 3 a la herramienta web. La trama visualiza las secuencias en estudio en comparación con las secuencias mutadas aleatoriamente y las secuencias analizadas minuciosamente en el estudio anterior o actual con respecto a la divergencia y la selección. Para evaluar la divergencia y la selección, usamos la relación entre la identidad de nucleótidos por pares promedio y la identidad de aminoácidos por pares promedio (Fig. 3). Como se muestra en la Fig. 3, las secuencias simuladas mutadas aleatoriamente forman un conjunto claro y estrecho en el gráfico. Se utilizaron secuencias mutadas aleatoriamente con una extensión definida (N mutaciones por pb) para modelar la evolución neutra y / o secuencias no divergentes (más detalles en "Materiales y métodos"). Las secuencias de origen natural utilizadas en el estudio anterior y en el actual se ubican claramente lejos de las secuencias simuladas.

Figura 3: La identidad media por pares de las secuencias de nucleótidos de la alineación de codones representada frente a la identidad media por pares de las secuencias de proteínas en los respectivos MSA.

Secuencias que tienen baja divergencia y / o que tienen una evolución cercana a la neutral

Como cRegions fue diseñado para trabajar en secuencias divergentes, el método puede dar posibles señales falsas positivas en secuencias de baja divergencia o en secuencias ubicadas cerca de secuencias de evolución neutra (Fig. 4 Fig. S8). Para evitar esto, recomendamos habilitar la corrección de umbral en la herramienta web. Al habilitar esta opción, los valores esperados se corrigen con los valores observados y se calcula el umbral ajustado (consulte "Materiales y métodos"). Esto elimina la mayor parte de la señal falsa positiva de las secuencias que están cerca de las secuencias que mutan aleatoriamente (Fig. 4 Fig. S8). Nos gustaría señalar que la corrección es necesaria sólo en el caso de secuencias que están cerca de las secuencias de evolución neutra / aleatoria (Fig. 3). Otra opción es utilizar synplot2 que utiliza la evolución neutra como hipótesis nula (Firth, 2014)

Figura 4: el número de señales en secuencias mutadas aleatoriamente.


Casos de estudio

Plasmodium detección de polimorfismo

Las regiones objetivo se amplificaron primero utilizando el protocolo estándar de PCR [35]. Los amplicones resultantes se secuenciaron con MinION utilizando el kit de secuenciación ONT SDK-MAP005 o SQK-MAP006 para la preparación de la biblioteca y la versión de celda de flujo FLO-MAP003. Las secuencias se alinearon contra el Plasmodium el genomaP. falciparum genoma de referencia basado en la cepa 3D7). Discusión exhaustiva de la utilidad ONT para Plasmodium Las llamadas a SNP y los métodos de preparación de bibliotecas se presentan en otro lugar [35]. NanoPipe logró mapear el 99,9% de todas las lecturas de consultas y detectar las mutaciones esperadas (ver Fig. 2). La característica específica del Plasmodium El genoma, múltiples repeticiones AT / T, se pueden observar fácilmente en la gráfica de nucleótidos. El análisis completo de una consulta de 21 MB (formato FASTA) contra el P. falciparum genoma con NanoPipe tomó menos de 4 minutos. Este ejemplo demuestra que el análisis de solo 10.157 lecturas MinION con un alto contenido de AT en NanoPipe da como resultado datos confiables. Las capturas de pantalla detalladas de los resultados de NanoPipe para este caso de estudio se pueden encontrar en el Material complementario (Figuras complementarias S2-S10).

Caso de muestra: Plasmodium detección de polimorfismo. (A) La tabla de polimorfismos muestra los tres candidatos a SNP: dos de ellos (en las posiciones 403 625 y 404 407) son mutaciones esperadas que conducen a cambios en los aminoácidos K76T y A220S y, como consecuencia, a una resistencia alterada del parásito a la cloroquina, mefloquina y fármacos quinina [35]. (B) Gráfico de nucleótidos. La flecha violeta apunta a la sustitución G & gtT en la posición 404 407 (cambio de codón GCC & gtTCC). La flecha naranja resalta una región rica en AT, la característica típica de la P. falciparum genoma.

Caso de muestra: Plasmodium detección de polimorfismo. (A) La tabla de polimorfismos muestra los tres candidatos a SNP: dos de ellos (en las posiciones 403 625 y 404 407) son mutaciones esperadas que conducen a cambios en los aminoácidos K76T y A220S y, como consecuencia, a una resistencia alterada del parásito a la cloroquina, mefloquina y fármacos quinina [35]. (B) Gráfico de nucleótidos. La flecha violeta apunta a la sustitución G & gtT en la posición 404 407 (cambio de codón GCC & gtTCC). La flecha naranja resalta una región rica en AT, la característica típica de la P. falciparum genoma.

Secuenciación dirigida de la transcripción de EGFR de la línea celular de adenocarcinoma de pulmón humano H1975

La región del ADNc de EGFR humano correspondiente a los exones 17-22 se amplificó utilizando los cebadores CTAAGATCCCGTCCATCGCC (directo) y ACATATGGGTGGCTGAGGGA (inverso). La preparación de la biblioteca se realizó siguiendo las recomendaciones del fabricante usando el kit SQK-LSK108 de ONT, y luego se realizó la secuenciación con el MinION usando la versión de celda de flujo FLO-MIN107 R9. Las lecturas 1D sin procesar (900 MB, formato FASTA) se cargaron en NanoPipe utilizando el genoma de referencia humano como objetivo, el análisis tomó 135 minutos. Un total del 79,9% de todas las lecturas se asignaron al gen EGFR en el cromosoma 7. La mayoría de las lecturas restantes (13,5%) se asignaron al cromosoma 11, a las regiones correspondientes al gen cortactin (NM_138565) que se sobreexpresa en diferentes cánceres [ 36], y el gen que codifica la subunidad 2 del complejo proteico del factor de empalme 3b (NM_006842). Este gen podría expresarse diferencialmente en los tejidos tumorales [37], sin embargo, no existe una investigación definitiva sobre las posibles funciones de este gen en los cánceres. Puede darse el caso de que el gen esté sobreexpresado en la línea celular H1975, por lo que su transcripción fue secuenciada como un contaminante abundante, similar a la transcripción cortactin. Se detectaron las cuatro mutaciones esperadas dentro de esta región en esta línea celular [38], ver Fig. 3. Este ejemplo demuestra la idoneidad de NanoPipe para el análisis de secuenciación del cáncer.

Caso de ejemplo: secuenciación dirigida de la transcripción de EGFR.(A) Resultados de polimorfismo. Las dos sustituciones de nucleótidos esperadas son silenciosas: G & gtA (CAG & gtCAA = Gln) en la posición 55 181370 y T & gtC (ACT & gtACC = Thr) en la posición 55 198 724 otras dos sustituciones en la posición 55181378 (C & gtT que conduce al cambio de aminoácido T745M) y en la posición 55 191 822 (T & gtG que conduce al cambio de aminoácido L813R) son responsables de la sensibilidad a los fármacos anticancerosos, en particular, a gefitinib y erlotinib [38]. (B) Gráfico de nucleótidos. El esquema de alejamiento en la parte inferior muestra siete selecciones de alineación que representan siete exones secuenciados de la transcripción. El gráfico de nucleótidos muestra la primera de estas selecciones, señalada por las flechas naranjas.

Caso de ejemplo: secuenciación dirigida de la transcripción de EGFR.(A) Resultados de polimorfismo. Las dos sustituciones de nucleótidos esperadas son silenciosas: G & gtA (CAG & gtCAA = Gln) en la posición 55 181370 y T & gtC (ACT & gtACC = Thr) en la posición 55 198 724 otras dos sustituciones en la posición 55181378 (C & gtT que conduce al cambio de aminoácido T745M) y en la posición 55 191 822 (T & gtG que conduce al cambio de aminoácido L813R) son responsables de la sensibilidad a los fármacos anticancerosos, en particular, a gefitinib y erlotinib [38]. (B) Gráfico de nucleótidos. El esquema de alejamiento en la parte inferior muestra siete selecciones de alineación que representan siete exones secuenciados de la transcripción. El gráfico de nucleótidos muestra la primera de estas selecciones, señalada por las flechas naranjas.

Análisis de RNA-seq de la especie de hormiga Camponotus maculatus

Se utilizó el kit Monarch Total RNA Miniprep (NEB) para la extracción de poli-A RNA de acuerdo con las recomendaciones del fabricante. La biblioteca se preparó usando el kit SQK-PCS108 de ONT y luego se secuenció con MinION usando la versión de celda de flujo FLO-MIN107 R9 siguiendo las recomendaciones del fabricante. Las lecturas 1D sin procesar en formato FASTA se cargaron en NanoPipe, el genoma de referencia de Camponotus floridanus se utilizó como el genoma objetivo, ya que ni el genoma ni el transcriptoma de C. maculatus están disponibles. El análisis de la consulta de 1,5 GB se ejecutó durante 3 horas. De 1,814,750 lecturas sin procesar, 1,773,747 (97.7%) se asignaron al objetivo, abarcando 431 andamios de 657, incluidos 150 andamios con cobertura de más de 1,000 lecturas por andamio. Este resultado es consistente con el número de lecturas secuenciadas y el hecho de que el objetivo era el genoma de una especie diferente. Por lo tanto, NanoPipe se puede utilizar para estudiar especies recién secuenciadas.

Secuencia de ARN directo de poxvirus aislado de las células hospedadoras del mono verde

Examinamos los datos recientes de la secuencia de ARN directo de MinION del Virus vaccinia WR ARNm aislado de las células de fibroblastos de riñón de Clorocebus sabeus (para obtener más información, consulte [39]). Usando el genoma del virus y el genoma del mono como objetivos en las dos ejecuciones separadas, podríamos separar las lecturas provenientes de los dos organismos. De las 29.846 lecturas probadas, 1.314 se asignaron al genoma del virus (acceso de GenBank LT966077.1) y 14.714 lecturas se asignaron al genoma del virus. C. sabeus genoma (acceso GenBank GCA_000 409795.2), que es consistente con los resultados publicados. La opción de carga directa del objetivo también se probó en los archivos de entrada pequeños y grandes (el tamaño del genoma del virus es de 198 KB y el genoma del mono verde es de 2,82 GB). Ambas ejecuciones se completaron con éxito en 12 segundos y en 51 minutos, respectivamente, incluida la construcción de las bases de datos de destino. NanoPipe demostró ser útil para analizar las lecturas largas mixtas de virus y su anfitrión.


El estudio de los repertorios de genes de especies microbianas, sus pangenomas, se ha convertido en una parte clave de la evolución microbiana y la genómica funcional. Sin embargo, el creciente número de genomas disponibles complica el establecimiento de los componentes básicos de la genómica comparada. A continuación, presentamos PanACoTA (https://github.com/gem-pasteur/PanACoTA), una herramienta que permite descargar todos los genomas de una especie, construir una base de datos con los que pasan los controles de calidad y redundancia, anotar uniformemente y luego construir sus pangenoma, varias variantes de genomas centrales, sus alineaciones y un árbol filogenético rápido pero preciso. Si bien muchos programas que crean pangenomas están disponibles en los últimos años, nos hemos centrado en un método modular que aborda todos los pasos clave del proceso, desde la descarga hasta la inferencia filogenética. Si bien todos los pasos están integrados, también se pueden ejecutar por separado y varias veces para permitir una exploración rápida y extensa de los parámetros de interés. PanACoTA está construido en Python3, incluye un contenedor de singularidad y características para facilitar su desarrollo futuro. Creemos que PanACoTa es una adición interesante al conjunto actual de herramientas de genómica comparativa, ya que acelerará y estandarizará las partes más rutinarias del trabajo, lo que permitirá a los genomicistas microbianos abordar más rápidamente sus preguntas específicas.

El bajo costo de la secuenciación y la disponibilidad de cientos de miles de genomas han hecho de la genómica comparada un conjunto de herramientas básico para muchos microbiólogos, genetistas y biólogos evolutivos. Muchas especies bacterianas de interés tienen ahora más de 100 genomas disponibles públicamente en la base de datos de referencia GenBank RefSeq, y algunas tienen más de diez mil. Esta tendencia aumentará con los costos cada vez menores de la secuenciación, la disponibilidad de tecnologías de lectura larga y el uso de la secuenciación del genoma completo en la clínica para el diagnóstico y la epidemiología. Como resultado, los investigadores que deseen utilizar los ensamblajes disponibles se enfrentan a cantidades extremadamente grandes de datos para analizar. La genómica comparada ha estimulado importantes contribuciones a la comprensión de la organización y evolución de los genomas bacterianos en las últimas dos décadas (1, 2). Se ha convertido en una herramienta estándar para los estudios epidemiológicos, donde el análisis de los genes comunes a un conjunto de cepas, el genoma central o persistente, proporciona una precisión incomparable en el seguimiento de la expansión de los clones de interés (3, 4). El uso de la secuenciación de rutina en la clínica requerirá además herramientas de análisis rápidas y confiables para consultar miles y, posiblemente, pronto millones de genomas de una sola especie (5). La genética de poblaciones también se beneficia de esta gran cantidad de datos porque ahora se puede rastrear en detalle el origen y el destino de las mutaciones o adquisiciones de genes para comprender lo que revelan de los procesos adaptativos o mutacionales (6). Finalmente, los estudios de asociación de todo el genoma se han adaptado recientemente a la genética bacteriana, para tener en cuenta las variantes en el polimorfismo de un solo nucleótido y los repertorios de genes (7). Tienen la promesa de ayudar a los biólogos a identificar la base genética de los fenotipos de interés. Dado el alto vínculo genético en los genomas bacterianos, estos estudios pueden requerir conjuntos de datos extremadamente grandes para detectar efectos pequeños. Más específicamente, la vacunación inversa también es una aplicación digna de mención de estos métodos pangenómicos, para identificar nuevos antígenos potenciales entre las proteínas del núcleo expuestas a la superficie de un clado dado (8).

La disponibilidad de grandes conjuntos de datos genómicos supone una pesada carga para los investigadores, especialmente aquellos que carecen de una formación extensa en bioinformática, porque su análisis implica el uso de procesos automáticos, herramientas eficientes, una amplia estandarización y control de calidad. Recientemente se han desarrollado muchas herramientas para realizar búsquedas rápidas de similitud de secuencias con excelentes tasas de recuperación de secuencias muy similares (9-11).

Otras herramientas proporcionan métodos para agrupar rápidamente un gran número de secuencias en familias de similitud de secuencias, para obtener las familias comunes a un conjunto de genomas, alinearlas o producir su filogenia, cuatro piedras angulares de la genómica comparativa. Recientemente se han publicado varios programas que incluyen algunas de estas herramientas para calcular pangenomas bacterianos (para una revisión, consulte (12)). Muchos de estos programas calculan alineaciones y grupos de familias utilizando programas que son muy rápidos. Utilizan herramientas que hacen algunos compromisos entre precisión y velocidad, como DIAMOND (9), USEARCH (13) y CD-HIT (14). Este último es utilizado, entre otros, por Roary (15), que actualmente es la herramienta más popular para calcular pangenomas, y Panaroo (16), una herramienta muy reciente que tiene como objetivo reducir el impacto de la anotación automática errónea de genomas procariotas. BPGA (17), utilizando USEARCH o CD-HIT para agrupar proteínas, también proporciona algunos análisis posteriores. PanX (18), que tiene una excelente interfaz gráfica, usa DIAMOND para buscar similitudes entre genes.

Más recientemente, SonicParanoid introdujo el uso del programa mmseqs2 altamente eficiente y preciso para construir pangenomas, y PPanGGOLiN utilizó la misma herramienta para proporcionar un método para clasificar estadísticamente familias de pangenomas en términos de su frecuencia (19-21). Algunos programas recientes también utilizan enfoques basados ​​en gráficos para refinar aún más los pangenomas, como PPanGGOLiN y Panaroo (16). De hecho, el análisis de un conjunto de datos de 319 Klebsiella pneumoniae Los genomas de ambas herramientas proporcionaron resultados similares (16). Algunas herramientas, como PIRATE (22), también se han desarrollado recientemente para agrupar ortólogos entre genomas distantes. Sin embargo, todos estos programas carecen de algunos o todos los pasos iniciales y finales que son esenciales en la genómica comparada, incluida la descarga, el control de calidad, la alineación y la inferencia filogenética. Esto estimuló el desarrollo de PanACoTA (PANgenome con anotaciones, identificación de núcleos, árbol y alineaciones correspondientes). Para aprovechar la gran cantidad de información genómica disponible públicamente, se necesitan seis bloques principales de operaciones. (i) Reúna un conjunto de genomas de un clado automáticamente. Esto requiere cierto control de calidad, para evitar borradores con un número excesivo de contigs. También suele ser conveniente comprobar que los genomas no sean demasiado redundantes, para minimizar el coste computacional y los sesgos debidos a la pseudo-replicación. Por otro lado, es importante comprobar que los genomas no están demasiado desrelacionados, para eliminar los genomas que se clasificaron erróneamente en términos de especies bacterianas (o la organización taxonómica de relevancia). (ii) Definir a priori una nomenclatura y anotación uniformes, sin las cuales el cálculo de pangenomas y genomas centrales se vuelve poco confiable para grandes conjuntos de datos. (iii) Producir el pangenoma, una matriz con los patrones de presencia / ausencia de cada familia de genes en el conjunto de genomas, utilizando un método preciso, simple y rápido. (iv) Utilice el pangenoma para identificar conjuntos de genes centrales o persistentes. (v) Producir múltiples alineamientos de las familias de genes de los genomas centrales o persistentes. (vi) Finalmente, producir rápidamente una filogenia razonablemente precisa del conjunto de genes centrales / persistentes. These four collections of data, pangenome, core genome, alignments and phylogenetic tree, are the basis of most microbial comparative genomics studies. At the end of this process, the researcher can produce more detailed analyses, specific to the questions of interest, which often lead to changes such as including/excluding taxa, changing the thresholds of sequence similarity, increasing alignment accuracy, or rebuilding phylogenies using different methods. Such re-definitions can be achieved more efficiently when pipelines are modular and allow to restart the analyses at several key points in the process.

Considering the current availability of pipelines for microbial comparative genomics, we have built one that is modular, easy to setup, uses state-of-the-art tools and allows simple re-use of intermediate results. The goal was to provide a pipeline that allows to download all genomes from a taxonomic group and make all basic comparative genomics work automatically. The pipeline is entirely built in a single language, Python v3, and uses modern methods to facilitate its future maintenance and to limit unwanted behavior. PanACoTA is freely available under the open source GNU AGPL license. Here, we describe the method and illustrate it with an analysis of two datasets of 225 complete and 3980 complete or draft genomes of K. pneumoniae. This species is interesting for our purposes because there are many genomes available and it has a very open pangenome ( 23). The first dataset describes a situation where sequence quality is usually high, and the second illustrates how the method scales-up to a very large dataset where some sequences and assemblies are of lower quality. The procedure is detailed in the Materials and Methods section, whereas the illustration of its use, and how it changes in relation to key options in the two datasets, is detailed in the Results section.


DATA DISTRIBUTION, SEARCHING AND SEQUENCE ANALYSIS

EBI network services

Database releases are produced quarterly, and integrated into the EBIs SRS server. Databases and software can also be downloaded from the EBIs FTP server. EBIs network services allow access to the most up-to-date data collection via the Internet. Data access to EMBL nucleotide sequence data is also granted via email using the netserver or interactively via the WWW where the main service comprises the SRS server.

Sequence retrieval system (SRS)

The SRS server at the EBI integrates and links a comprehensive collection of specialised databanks along with the main nucleotide and protein databases. The SRS system ( 9) allows the databases to be searched using a number of fields including sequence annotations, keywords and author names. Complex querying and linking across all available databanks can also be executed and users should refer to the detailed instructions which are available online at http://srs.ebi.ac.uk/

Sequence searching

The EBI provides a comprehensive set of sequence similarity algorithms that can be accessed both interactively from the EMBL EBI WWW site (http://www.ebi.ac.uk/Tools/) or by email. The EMBL Nucleotide Sequence Database can be searched as a whole or by individual taxonomic division. The most commonly used algorithms available are Fasta3 ( 10) and WU-Blast2 ( 11 WU-blast HELP page). Fasta3 will find a single high-scoring gapped alignment between the query nucleotide sequence and database sequences. Comparisons between a nucleotide sequence and the protein databases can be made using fastx/y3, whilst t fastx/y3 allows comparisons between a protein sequence and the translated DNA databank. The EBIs Smith and Watermann ( 12) service comprises a comprehensive set of programs. These include today Compugen’s Bic_SW, MPsrch (reference—see help page) and Scanps (reference—see help page). These facilitate more sensitive searches against protein sequence databases.

Análisis de secuencia

Specialised sequence analysis programs are also available from the EBI. Such services include multiple sequence alignment and inference of phylogenies using CLUSTALW ( 13), Gene prediction using GeneMark ( 14), pattern searching and discovery using PRATT ( 15), Motif identification using ppsearch (reference—see help page) as well as applications which have been developed in-house for various other projects.

EMBnet

The European Molecular Biology Network (http://www.embnet.org) was initiated in 1988 to link major European laboratories that provide bioinformatics to national scientific communities as well as being involved in active R&D in the fields of sequence analysis. One of the main tasks of the EMBnet network is the maintenance and updating of remote copies of the nucleotide and protein sequence databases which are updated daily. As bioinformatics grows, EMBnet plays an important role in providing a comprehensive program of bioinformatics training aimed specifically at both the wet lab researcher as well as programmers and systems administrators. A full listing of sites maintaining daily updated copies of the EMBL Database is available from the EBI at http://www.ebi.ac.uk/embl/Access/other_sites.html


Introducción

The amount of data used in modern phylogenetics has increased dramatically since the advent of next-generation sequencing (McCormack et al., 2013). Data sets composed of hundreds or thousands of loci are becoming commonplace. Efficient concatenation of alignments is important in modern phylogenetics where multiple concatenation procedures are often carried out to explore how phylgoenetic signal is structured across the data. For example, two recent phylogenomic studies (Sharma et al., 2014 Borowiec et al., 2015) required concatenation and independent inference on dozens of data sets varying e.g., in rate of evolution or the amount of missing data. Alignment summary statistics are also needed for identification and filtering out “gappy” or fast-evolving data from downstream analyses such as the ones carried out in the studies cited above. Because the size of alignments used in phylogenetics is growing rapidly, there is a need for a fast and easy to use tool that can supplement existing phylogenomic pipelines. Available tools used for concatenation of alignments are either unable to correctly parse all alignment formats, are not flexible in the output format, or are slow to work on very large data sets (see Performance section below). Modern phylogenetic analysis often requires a form of bioinformatics pipeline where output of one procedure is being redirected as input for another tool. Although a number of freely available tools for manipulating alignments and computing their basic statistics exist, some of the most popular ones are based on graphical user interfaces (e.g., Mesquite: Maddison & Maddison, 2015) and not appropriate for command-line or scripted pipeline analyses. Examples of command-line tools with functionality partially overlapping with AMAS are FASconCAT-G Kück & Longo (2014) and Phyutility Smith & Dunn (2008). Phyutility and FASconCAT-G both allow for concatenation and the latter is additionally capable of computing various alignment statistics. All three programs have a broad range of functions and direct comparisons are difficult (see Table 1 for an overview of functions). More specifically, in addition to conversion, concatenation, and producing alignment summaries, FASconCAT-G allows the user to, among other functions, write MrBayes blocks in NEXUS files or create consensus sequences. Phyutility also allows for interactions with the NCBI databases and a number of manipulations on phylogenetic trees. Because of the many non-overlapping functions of these programs, the comparisons here focus on computing time required for concatenation. It should also be emphasized that the tools compared here should be viewed as complementary and AMAS is not intended to replace them. As demonstrated below, however, AMAS outperforms both FASconCAT-G and Phyutility at concatenation on a single core of a desktop computer. AMAS also supports parallel processing for even faster computation using multiple cores. It is easy to install and use, requires only a standard distribution of Python 3 or newer, and is provided with a detailed instructions manual.

Función AMAS FASconCAT-G Phyutility
Input formats fasta phylip nexus clustal fasta phylip nexus fasta nexus
Concatenation
Splitting or site extraction yes (gaps only)
Summary statistics no
Replicate alignments no no
Taxon removal no no
Traducción no no
RY coding no no
Consensus sequences no no
NCBI interactions no no
Tree manipulations no no

Tool for nucleotide alignment with all nucleotide codes (e.g. R, Y, W, S, etc.)? - biología

Whole-genome classification using Average Nucleotide Identity

If you would like to contribute code to the pyani project (e.g. a bug fix or new feature), please refer to the CONTRIBUTING.md guide for more details.

and we are grateful to all who have contributed to this software:

(This project follows the all-contributors specification. Contributions of any kind welcome!)

A complete guide to citing pyani is included in the file CITATIONS . Please cite the following manuscript in your work, if you have found pyani useful:

Pritchard et al. (2016) "Genomics and taxonomy in diagnostics for food security: soft-rotting enterobacterial plant pathogens" Anal. Métodos 8, 12-24 DOI: 10.1039/C5AY02550H

pyani is a software package and Python3 module that calculates average nucleotide identity (ANI) and related measures for whole genome comparisons, and renders relevant graphical summary output.

Where available, pyani can take advantage of multicore systems, and integrates with SGE/OGE-type job schedulers for the sequence comparisons.

pyani installs the prgram pyani , which enables command-line based analysis of genomes.

THIS REPOSITORY DEFAULT BRANCH CONTAINS A DEVELOPMENT VERSION OF PYANI (v0.3+). IT HAS A DIFFERENT COMMAND-LINE INTERFACE THAN THE STABLE PYANI VERSION (v0.2.x).

Documentation for stable version pyani v0.2.x

IF YOU WISH TO INSTALL THE STABLE VERSION OF PYANI , PLEASE FOLLOW THESE INSTRUCTIONS FOR INSTALLING v0.2.x

The easiest way to install pyani v0.2 is to use conda or pip . conda is recommended for the simplest installation of third-party tool dependencies ( mummer and BLAST / BLAST+ ).

You will need to install the bioconda channel, following instructions at https://bioconda.github.io/user/install.html. Then, to create a new environment for pyani and install the program, issue the following command:

pip will install pyani and its Python dependencies, but not the third-party tools.

Three alignment packages are required, to use all of pyani 's methods: mummer , BLAST+ , and legacy BLAST . (Note that it is not necessary to install all three tools to use pyani . You need only install the tools that are required for the method you wish to use.)

The simplest route to obtaining these tools is to use conda / bioconda :

But they can also be installed by following instructions from the tools' own websites.

  • BLAST+ (for anib ) ftp://ftp.ncbi.nlm.nih.gov/blast/executables/blast+/LATEST/
  • legacy BLAST (for aniblastall ) ftp://ftp.ncbi.nlm.nih.gov/blast/executables/release/LATEST/
  • MUMmer (for anim ) http://mummer.sourceforge.net/

NOTE: Installing legacy BLAST

The legacy BLAST executable available from NCBI will not run on macOS Big Sur.

If you wish to use pyani blastall or the ANIblastall method with the legacy pyani interface, you will require a locally-installed copy of this package. This is one of the packages linked in the requirements-thirdparty.txt file.

This README.md file provides a quick overview and walkthrough for THE DEVELOPMENT VERSION (v0.3+) OF pyani , and full documentation can be found at the link below:

THIS README AND THE DOCUMENTATION AT READTHEDOCS REFERS TO A DEVELOPMENT VERSION OF PYANI (v0.3+). IT HAS A DIFFERENT COMMAND-LINE INTERFACE THAN THE STABLE PYANI VERSION (v0.2.x).

THE STABLE VERSION OF PYANI (v0.2) DOES NOT HAVE THE pyani COMMAND

If you are using pyani v0.2.x, then please note that the command-line API has changed, and documentation for this version can be found at the following page:

Bugs, issues, problems and questions

If you would like to report a bug or problem with pyani , or ask a question of the developer(s), please raise an issue at the link below:

Walkthrough: A First Analysis

The command-line interface to pyani uses subcommands. These separate individual steps of an analysis into separate actions.

  1. Download genomes
  2. Create a database to hold genome data and analysis results
  3. Perform ANI analysis
  4. Report and visualise analysis results
  5. Generate species hypotheses (classify genomes) using the analysis results

The steps are described in detail with examples, below.

The first step is to obtain genome data for analysis. pyani expects to find each individual genome in its own FASTA file (that file can contain multiple sequences - chromosomes and plasmids sequenced scaffolds, etc). All the FASTA files for an analysis are expected to be located in a single subdirectory (with optional labels and classes files). You can arrange your data manually, but pyani provides a subcommand that downloads all genomes in a taxon subtree from NCBI, and organises them ready for use with pyani .

We'll use the pyani download subcommand to download all available genomes for Candidatus Blochmannia from NCBI. The taxon ID for this grouping is 203804.

The first argument is the output directory into which the downloaded genomes will be written ( C_blochmannia ). To download anything from NCBI we must provide an email address ( --email [email protected] ), and to specify which taxon subtree we want to download we provide the taxon ID ( -t 203804 ).

Here we also request verbose output ( -v ), and write a log file for reproducible research/diagnosing bugs and errors ( -l C_blochmannia_dl.log ).

This produces a new subdirectory ( C_blochmannia ) with the following contents:

Seven genomes have been downloaded, and each is represented by four files:

  • _genomic.fna.gz : the compressed genome sequence
  • _genomic.fna : the uncompressed genome sequence
  • _genomic.md5 : an MD5 hash/checksum of the (uncompressed) genome sequence this was generated during the download
  • _hashes.txt : a list of MD5 hashes this is provided by NCBI and is a reference to be sure that the download did not corrupt the genome sequence

There are two additional plain text files: classes.txt and labels.txt , which provide alternative labels for use in the analysis. These files are generated during the download.

2. Create an analysis database

pyani uses a database to store genome data and analysis results. This is convenient for data sharing and developing custom analyses, but also makes it easier to extend an existing ANI analysis with new genomes, without having to repeat calculations that were already performed.

To create a new, clean, database in the default location ( .pyani/pyanidb ) issue the command:

As above, the verbose ( -v ) and log file ( -l C_blochmannia_createdb.log ) options allow for reproducible work. The default database location is in the hidden directory ( .pyani ):

Subsequent pyani commands will assume this location for the database, but you can specify the location when creating a database, or using an existing database.

pyani provides four subcommands to run ANI analyses:

  • anim : ANIm
  • anib : ANIb, using BLAST+
  • aniblastall : ANIb, using legacy BLAST
  • tetra : TETRA

In this walkthrough, we'll run ANIm on the downloaded genomes, using the command:

All four analysis commands operate in a similar way. The first two arguments are paths to directories: the first path is to a directory containing input genomes, and the second is the path to an output directory for storing intermediate results. The -v and -l arguments work as above, specifying verbose output and logging output to a file.

You will probably notice that the verbose output is very verbose, to enable informative identification of any problems. In particular, the verbose output (which is also written to the log file) writes out the command-lines used for the pairwise comparisons so, if something goes wrong, you can test whether a specific comparison can be run at the command-line en absoluto, to aid diagnosis of any problems.

Rerunning the same analysis

One reason for using a database backend for analysis results is so that, for very large analyses, we do not ever need to recalculate a pairwise genome comparison. All the analysis subcommands check whether input genomes have been used before (using the unique MD5 hash for each genome to identify whether it's been used previously), and whether the comparison of two genomes has been run, with the particular analysis settings that were used. If either genome was not seen before, or if the analysis settings are different, the comparison is performed.

You can test this for yourself by running the analysis command again, as below. You will see a number of messages indicating that genomes have been seen before, and that analyses performed before were skipped:

4. Reporting Analyses and Analysis Results

Once an analysis is run, the results are placed in a local SQLite database, which can be queried for information about the analyses that have been run. You can request information about:

  • --runs : show all analysis runs with results stored in the database
  • --runs_genomes : show all the analysis runs with results in the database, and all the genomes analysed in each run
  • --genomes : show all the genomes used for any analysis in the database
  • --genomes_runs : for each genome in the database, also list the analysis results it participates in
  • --run_results : show all the pairwise comparison results for a named run (run IDs can be obtained with the --runs argument

The report tables are written to a named directory (compulsory argument), and are written by default to a .tab plain-text format, but HTML and Excel format can also be requested with the --formats argument:

To see all of the pairwise results for an individual run, the run ID must be provided. It is possible to get results for more than one run ID by providing a comma-separated list of run IDs (though each run's results will be provided in a separate file):

You can see a run's results in the terminal by specifying the stdout format. For example, to see the identity, coverage, and other output matrices, you would specify --run_matrices <RUN> and --formats=stdout as below:

5. Generating graphical output for ANI

The output of a pyani run can also be represented graphically, using the plot subcommand. For example, the command:

will place .pdf and .png format output in the C_blochmannia_ANIm output directory for the run with ID 1, generated above. Five heatmaps are generated:

  • percentage identity
  • percentage coverage (for both query and subject)
  • alignment length (total aligned length)
  • similarity errors (total number of mismatches, not including indels)
  • hadamard matrix (dot product of identity and coverage matrices)

The heatmaps also include dendrograms, clustering the rows and columns by overall similarity.

NOTA: Running pyani plot with a large number of genomes (

500) and the default figure output ( --method seaborn ) may reduce output figure quality:

  • labels in .png files may be difficult to read
  • .pdf files may render very slowly due to the large number of numerical values in heatmap cells.

With large datasets, --method mpl (matplotlib) is recommended.

Please be aware that the matrix orientation differs for these two options so, with seaborn (the default, --method seaborn ), the orientation of self-comparisons is top left to bottom right ( ), while with matplotlib ( --method mpl ) the orientation is bottom left to top right ( / ).

6. Classifying Genomes from Analysis Results

Running pyani version 0.2.x

The average_nucleotide_identity.py script - installed as part of this package - enables straightforward ANI analysis at the command-line, and uses the pyani module behind the scenes.

You can get a summary of available command-line options with average_nucleotide_identity.py -h

Example data and output can be found in the directory test_ani_data . The data are chromosomes of four isolates of Caulobacter. Basic analyses can be performed with the command lines:

The graphical output below, supporting assignment of NC_002696 and NC_011916 to the same species (C.crescentus), and the other two isolates to distinct species ( NC_014100 :C.segnis NC_010338 :C. sp K31), was generated with the command-line:

The script genbank_get_genomes_by_taxon.py , installed by this package, enables download of genomes from NCBI, specified by taxon ID. The script will download all available assemblies for taxa at or below the specified node in the NCBI taxonomy tree.

Command-line options can be viewed using:

For example, the NCBI taxonomy ID for Caulobacter is 75, so all publicly-available Caulobacter sequences can be obtained using the command-line:

NOTA: You must provide a valid email to identify yourself to NCBI for troubleshooting.

The number of attempted retries for each download, and the size of a batch download can be modified. By default, the script will attempt 20 download retries, and obtain sequences in batches of 10,000.

Method and Output Description

Average Nucleotide Identity (ANI)

This module calculates Average Nucleotide Identity (ANI) according to one of a number of alternative methods described in, e.g.

  • Richter M, Rossello-Mora R (2009) Shifting the genomic gold standard for the prokaryotic species definition. Proc Natl Acad Sci USA 106: 19126-19131. doi:10.1073/pnas.0906412106. (ANI1020, ANIm, ANIb)
  • Goris J, Konstantinidis KT, Klappenbach JA, Coenye T, Vandamme P, et al. (2007) DNA-DNA hybridization values and their relationship to whole-genome sequence similarities. Int J Syst Evol Micr 57: 81-91. doi:10.1099/ijs.0.64483-0.

ANI is proposed to be the appropriate en silico substitute for DNA-DNA hybridisation (DDH), and so useful for delineating species boundaries. A typical percentage threshold for species boundary in the literature is 95% ANI (e.g. Richter et al. 2009).

All ANI methods follow the basic algorithm:

  • Align the genome of organism 1 against that of organism 2, and identify the matching regions.
  • Calculate the percentage nucleotide identity of the matching regions, as an average for all matching regions.

Methods differ on: (1) what alignment algorithm is used, and the choice of parameters (this affects the aligned region boundaries) (2) what the input is for alignment (typically either fragments of fixed size, or the most complete assembly available).

  • ANIm: uses MUMmer (NUCmer) to align the input sequences
  • ANIb: uses BLASTN+ to align 1020nt fragments of the input sequences
  • ANIblastall: uses legacy BLASTN to align 10al20nt fragments of the input sequences
  • TETRA: calculates tetranucleotide frequencies of each input sequence

The algorithms take as input correctly-formatted FASTA multiple sequence files. All sequences for a single organism should be contained in only one sequence file. Although it is possible to provide new labels for each input genome for rendering graphical output, the names of these files are used for identification so it is best to name them sensibly.

Output is written to a named directory. The output files differ depending on the chosen ANI method.

  • ANIm: MUMmer/NUCmer .delta files, describing each pairwise sequence alignment. Output as tab-separated plain text format tables describing: alignment coverage total alignment lengths similarity errors and percentage identity (ANIm).
  • ANIb y ANIblastall: FASTA sequences describing 1020nt fragments of each input sequence BLAST nucleotide databases - one for each set of fragments and BLASTN output files (tab-separated tabular format plain text) - one for each pairwise comparison of input sequences. Output as tab-separated plain text tables describing: alignment coverage total alignment lengths similarity errors and percentage identity (ANIb or ANIblastall).
  • TETRA: Tab-separated plain text files describing the Pearson correlations between Z-score distributions for each tetranucleotide in each input sequence (TETRA).

If graphical output is chosen, the output directory will also contain PDF, PNG and EPS files representing the various output measures as a heatmap with row and column dendrograms. Other output formats (e.g. SVG) can be specified with the --gformat argument.

Unless otherwise indicated, all code is subject to the following agreement:


Ver el vídeo: El código genético nucleótidos y aminoácidos (Julio 2022).


Comentarios:

  1. Cairbre

    Por extraño que parezca, pero no está claro

  2. Yoran

    Es interesante. Dime, por favor, ¿dónde puedo aprender más sobre esto?

  3. Royall

    Lo siento, pero creo que estás cometiendo un error. Puedo defender mi posición. Envíame un correo electrónico a PM, hablaremos.

  4. Mutaxe

    Curiosamente, ni siquiera pensé en eso ...

  5. Mogar

    Encuentro que no tienes razón. Estoy seguro. Discutiremos. Escribe en PM, nos comunicaremos.

  6. F'enton

    Tienes toda la razón. En esto algo es y es una excelente idea. Está listo para apoyarlo.



Escribe un mensaje